VHL cDNA ORF Clone, Rat, N-Myc tag

Cat: RG80944-NM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All VHL Reagents
CRO Services
Product recommended

All VHL Reagents
VHL cDNA ORF Clone, Rat, N-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
558 bp
Description
Full length Clone DNA of Rat von Hippel-Lindau tumor suppressor, E3 ubiquitin protein ligase with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

VHL Background Information
Full Name
von Hippel-Lindau tumor suppressor, E3 ubiquitin protein ligase

VHL cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
VHL cDNA ORF Clone in Cloning Vector, Rat RG80944-U
VHL cDNA ORF Clone, Rat, untagged RG80944-UT
VHL Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80944-ACGLN
VHL cDNA ORF Clone, Rat, C-GFPSpark® tag RG80944-ACG
VHL cDNA ORF Clone, Rat, N-GFPSpark® tag RG80944-ANG
VHL cDNA ORF Clone, Rat, C-OFPSpark® tag RG80944-ACR
VHL cDNA ORF Clone, Rat, N-OFPSpark® tag RG80944-ANR
VHL cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80944-CF
VHL cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80944-NF
VHL cDNA ORF Clone, Rat, C-His tag RG80944-CH
VHL cDNA ORF Clone, Rat, N-His tag RG80944-NH
VHL cDNA ORF Clone, Rat, C-HA tag RG80944-CY
VHL cDNA ORF Clone, Rat, N-HA tag RG80944-NY
VHL cDNA ORF Clone, Rat, C-Myc tag RG80944-CM
VHL qPCR Primer Pairs, Rat RP300908

VHL cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
VHL cDNA ORF Clone in Cloning Vector, Mouse MG57368-U
VHL cDNA ORF Clone, Mouse, untagged MG57368-UT
VHL Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG57368-ACGLN
VHL cDNA ORF Clone, Mouse, C-GFPSpark® tag MG57368-ACG
VHL cDNA ORF Clone, Mouse, N-GFPSpark® tag MG57368-ANG
VHL cDNA ORF Clone, Mouse, C-OFPSpark® tag MG57368-ACR
VHL cDNA ORF Clone, Mouse, N-OFPSpark® tag MG57368-ANR
VHL cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG57368-CF
VHL cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG57368-NF
VHL cDNA ORF Clone, Mouse, C-His tag MG57368-CH
VHL cDNA ORF Clone, Mouse, N-His tag MG57368-NH
VHL cDNA ORF Clone, Mouse, C-HA tag MG57368-CY
VHL cDNA ORF Clone, Mouse, N-HA tag MG57368-NY
VHL cDNA ORF Clone, Mouse, C-Myc tag MG57368-CM
VHL cDNA ORF Clone, Mouse, N-Myc tag MG57368-NM

VHL cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
VHL cDNA ORF Clone, Human, untagged HG17359-UT
VHL Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG17359-ACGLN
info info
添加购物车成功! 添加购物车失败!