VEGFA cDNA ORF Clone, Rat, C-Myc tag

Cat: RG80006-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All VEGFA Reagents
CRO Services
Product recommended

All VEGFA Reagents
VEGFA cDNA ORF Clone, Rat, C-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
573 bp
Description
Full length Clone DNA of Rat vascular endothelial growth factor A with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

VEGFA Background Information

Vascular endothelial growth factor (VEGF), also known as vascular permeability factor (VPF) and VEGF-A, is a potent mediator of both angiogenesis and vasculogenesis in the fetus and adult. It is a member of the platelet-derived growth factor (PDGF)/vascular endothelial growth factor (VEGF) family and often exists as a disulfide-linked homodimer. VEGF-A protein is a glycosylated mitogen that specifically acts on endothelial cells and has various effects, including mediating increased vascular permeability, inducing angiogenesis, vasculogenesis and endothelial cell growth, promoting cell migration, inhibiting apoptosis and tumor growth. VEGF-A protein is also a vasodilator that increases microvascular permeability, thus it was originally referred to as vascular permeability factor.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
vascular endothelial growth factor A
References
  • Woolard J. et al. (2004) VEGF165b, an inhibitory vascular endothelial growth factor splice variant: mechanism of action, in vivo effect on angiogenesis and endogenous protein expression. Cancer Res. 64(21): 7822-7835.
  • Jia SF, et al. (2008) VEGF165 is necessary to the metastatic potential of Fas(-) osteosarcoma cells but will not rescue the Fas(+) cells. J Exp Ther Oncol. 7(2): 89-97.
  • Cimpean AM, et al. (2008) Vascular endothelial growth factor A (VEGF A) as individual prognostic factor in invasive breast carcinoma. Rom J Morphol Embryol. 49(3): 303-8.
  • Hamdollah Zadeh MA, et al. (2008) VEGF-mediated elevated intracellular calcium and angiogenesis in human microvascular endothelial cells in vitro are inhibited by dominant negative TRPC6. Microcirculation. 15(7): 605-14.
  • Eisenach PA, et al. (2010) MT1-MMP regulates VEGF-A expression through a complex with VEGFR-2 and Src. J Cell Sci. 123(Pt 23):4182-4193.
  • Claesson-Welsh L (2010) Gremlin: vexing VEGF receptor agonist. Blood. 116(18):3386-7.
  • VEGFA cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    VEGFA cDNA ORF Clone in Cloning Vector, Rhesus CG90325-G
    VEGFA cDNA ORF Clone in Cloning Vector, Rhesus CG90326-G
    VEGFA cDNA ORF Clone, Rhesus, untagged CG90326-UT
    VEGFA cDNA ORF Clone, Rhesus, untagged CG90325-UT
    VEGFA Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90326-ACGLN
    VEGFA cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90326-ACG
    VEGFA cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90325-ACG
    VEGFA Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90325-ACGLN
    VEGFA cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90325-ACR
    VEGFA cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90326-ACR
    VEGFA cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90325-CF
    VEGFA cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90326-CF
    VEGFA cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90325-NF
    VEGFA cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90326-NF
    VEGFA cDNA ORF Clone, Rhesus, C-His tag CG90325-CH
    VEGFA cDNA ORF Clone, Rhesus, C-His tag CG90326-CH
    VEGFA cDNA ORF Clone, Rhesus, N-His tag CG90325-NH
    VEGFA cDNA ORF Clone, Rhesus, N-His tag CG90326-NH
    VEGFA cDNA ORF Clone, Rhesus, C-HA tag CG90325-CY
    VEGFA cDNA ORF Clone, Rhesus, C-HA tag CG90326-CY
    VEGFA cDNA ORF Clone, Rhesus, N-HA tag CG90325-NY
    VEGFA cDNA ORF Clone, Rhesus, N-HA tag CG90326-NY
    VEGFA cDNA ORF Clone, Rhesus, C-Myc tag CG90326-CM
    VEGFA cDNA ORF Clone, Rhesus, C-Myc tag CG90325-CM
    VEGFA cDNA ORF Clone, Rhesus, N-Myc tag CG90325-NM
    VEGFA cDNA ORF Clone, Rhesus, N-Myc tag CG90326-NM

    VEGFA cDNA ORF Clone, Canine, Related Products

    Product Name Catalog#(PDF)
    VEGFA cDNA ORF Clone in Cloning Vector, Canine DG70004-G
    VEGFA cDNA ORF Clone, Canine, untagged DG70004-UT
    VEGFA Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70004-ACGLN
    VEGFA cDNA ORF Clone, Canine, C-GFPSpark® tag DG70004-ACG
    VEGFA cDNA ORF Clone, Canine, C-OFPSpark® tag DG70004-ACR
    VEGFA cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70004-CF
    VEGFA cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70004-NF
    VEGFA cDNA ORF Clone, Canine, C-His tag DG70004-CH
    VEGFA cDNA ORF Clone, Canine, N-His tag DG70004-NH
    VEGFA cDNA ORF Clone, Canine, C-HA tag DG70004-CY
    VEGFA cDNA ORF Clone, Canine, N-HA tag DG70004-NY
    VEGFA cDNA ORF Clone, Canine, C-Myc tag DG70004-CM
    VEGFA cDNA ORF Clone, Canine, N-Myc tag DG70004-NM

    VEGFA cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    VEGFA cDNA ORF Clone in Cloning Vector, Rat RG80006-G
    VEGFA cDNA ORF Clone, Rat, untagged RG80006-UT
    VEGFA Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80006-ACGLN
    VEGFA cDNA ORF Clone, Rat, C-GFPSpark® tag RG80006-ACG
    VEGFA cDNA ORF Clone, Rat, C-OFPSpark® tag RG80006-ACR
    VEGFA cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80006-CF
    VEGFA cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80006-NF
    VEGFA cDNA ORF Clone, Rat, C-His tag RG80006-CH
    VEGFA cDNA ORF Clone, Rat, N-His tag RG80006-NH
    VEGFA cDNA ORF Clone, Rat, C-HA tag RG80006-CY
    VEGFA cDNA ORF Clone, Rat, N-HA tag RG80006-NY
    VEGFA cDNA ORF Clone, Rat, N-Myc tag RG80006-NM
    VEGFA qPCR Primer Pairs, Rat RP300410

    VEGFA cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    VEGFA cDNA ORF Clone in Cloning Vector, Mouse MG50159-M
    VEGFA cDNA ORF Clone, Mouse, untagged MG50159-UT
    VEGFA Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50159-ACGLN
    VEGFA cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50159-ACG
    VEGFA cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50159-ACR
    VEGFA cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50159-CF
    VEGFA cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50159-NF
    VEGFA cDNA ORF Clone, Mouse, C-His tag MG50159-CH
    VEGFA cDNA ORF Clone, Mouse, N-His tag MG50159-NH
    VEGFA cDNA ORF Clone, Mouse, C-HA tag MG50159-CY
    VEGFA cDNA ORF Clone, Mouse, N-HA tag MG50159-NY
    VEGFA cDNA ORF Clone, Mouse, C-Myc tag MG50159-CM
    VEGFA cDNA ORF Clone, Mouse, N-Myc tag MG50159-NM
    VEGFA qPCR Primer Pairs, Mouse MP200189

    VEGFA cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    VEGFA cDNA ORF Clone in Cloning Vector, Human HG10009-M
    VEGFA cDNA ORF Clone in Cloning Vector, Human HG10008-M
    VEGFA cDNA ORF Clone in Cloning Vector, Human HG11066-G
    VEGFA cDNA ORF Clone, Human, untagged HG11066-UT
    VEGFA cDNA ORF Clone, Human, untagged HG10008-UT
    VEGFA cDNA ORF Clone, Human, untagged HG10009-UT
    VEGFA cDNA ORF Clone, Human, C-GFPSpark® tag HG10008-ACG
    VEGFA Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10008-ACGLN
    VEGFA Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11066-ACGLN
    VEGFA Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10009-ACGLN
    VEGFA cDNA ORF Clone, Human, C-GFPSpark® tag HG11066-ACG
    VEGFA cDNA ORF Clone, Human, C-GFPSpark® tag HG10009-ACG
    VEGFA cDNA ORF Clone, Human, C-OFPSpark® tag HG10009-ACR
    VEGFA cDNA ORF Clone, Human, C-OFPSpark® tag HG10008-ACR
    VEGFA cDNA ORF Clone, Human, C-OFPSpark® tag HG11066-ACR
    VEGFA cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10009-CF
    VEGFA cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10008-CF
    VEGFA cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11066-CF
    VEGFA cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11066-NF
    VEGFA cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10008-NF
    VEGFA cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10009-NF
    VEGFA cDNA ORF Clone, Human, C-His tag HG10008-CH
    VEGFA cDNA ORF Clone, Human, C-His tag HG10009-CH
    VEGFA cDNA ORF Clone, Human, C-His tag HG11066-CH
    VEGFA cDNA ORF Clone, Human, N-His tag HG10009-NH
    VEGFA cDNA ORF Clone, Human, N-His tag HG10008-NH
    VEGFA cDNA ORF Clone, Human, N-His tag HG11066-NH
    VEGFA cDNA ORF Clone, Human, C-HA tag HG11066-CY
    VEGFA cDNA ORF Clone, Human, C-HA tag HG10009-CY
    VEGFA cDNA ORF Clone, Human, C-HA tag HG10008-CY
    VEGFA cDNA ORF Clone, Human, N-HA tag HG11066-NY
    VEGFA cDNA ORF Clone, Human, N-HA tag HG10008-NY
    VEGFA cDNA ORF Clone, Human, N-HA tag HG10009-NY
    VEGFA cDNA ORF Clone, Human, C-Myc tag HG10009-CM
    VEGFA cDNA ORF Clone, Human, C-Myc tag HG11066-CM
    VEGFA cDNA ORF Clone, Human, C-Myc tag HG10008-CM
    VEGFA cDNA ORF Clone, Human, N-Myc tag HG10008-NM
    VEGFA cDNA ORF Clone, Human, N-Myc tag HG11066-NM
    VEGFA cDNA ORF Clone, Human, N-Myc tag HG10009-NM
    VEGFA qPCR Primer Pairs, Human HP100106
    info info
    添加购物车成功! 添加购物车失败!