VDAC2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag

Cat: RG81228-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All VDAC2 Reagents
CRO Services
Product recommended

All VDAC2 Reagents
VDAC2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
888 bp
Description
Full length Clone DNA of Rat voltage-dependent anion channel 2 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

VDAC2 Background Information
Full Name
voltage-dependent anion channel 2

VDAC2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
VDAC2 cDNA ORF Clone in Cloning Vector, Rat RG81228-U
VDAC2 cDNA ORF Clone, Rat, untagged RG81228-UT
VDAC2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81228-ACG
VDAC2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81228-ACGLN
VDAC2 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81228-ANG
VDAC2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81228-ACR
VDAC2 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81228-ANR
VDAC2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81228-NF
VDAC2 cDNA ORF Clone, Rat, C-His tag RG81228-CH
VDAC2 cDNA ORF Clone, Rat, N-His tag RG81228-NH
VDAC2 cDNA ORF Clone, Rat, C-HA tag RG81228-CY
VDAC2 cDNA ORF Clone, Rat, N-HA tag RG81228-NY
VDAC2 cDNA ORF Clone, Rat, C-Myc tag RG81228-CM
VDAC2 cDNA ORF Clone, Rat, N-Myc tag RG81228-NM
VDAC2 qPCR Primer Pairs, Rat RP301184

VDAC2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
VDAC2 cDNA ORF Clone in Cloning Vector, Mouse MG52251-U
VDAC2 cDNA ORF Clone, Mouse, untagged MG52251-UT
VDAC2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52251-ACGLN
VDAC2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52251-ACG
VDAC2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52251-ANG
VDAC2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52251-ACR
VDAC2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52251-ANR
VDAC2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52251-CF
VDAC2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52251-NF
VDAC2 cDNA ORF Clone, Mouse, C-His tag MG52251-CH
VDAC2 cDNA ORF Clone, Mouse, N-His tag MG52251-NH
VDAC2 cDNA ORF Clone, Mouse, C-HA tag MG52251-CY
VDAC2 cDNA ORF Clone, Mouse, N-HA tag MG52251-NY
VDAC2 cDNA ORF Clone, Mouse, C-Myc tag MG52251-CM
VDAC2 cDNA ORF Clone, Mouse, N-Myc tag MG52251-NM
VDAC2 qPCR Primer Pairs, Mouse MP202124

VDAC2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
VDAC2 cDNA ORF Clone in Cloning Vector, Human HG16980-U
VDAC2 cDNA ORF Clone, Human, untagged HG16980-UT
VDAC2 cDNA ORF Clone, Human, C-GFPSpark® tag HG16980-ACG
VDAC2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16980-ACGLN
VDAC2 cDNA ORF Clone, Human, N-GFPSpark® tag HG16980-ANG
VDAC2 cDNA ORF Clone, Human, C-OFPSpark® tag HG16980-ACR
VDAC2 cDNA ORF Clone, Human, N-OFPSpark® tag HG16980-ANR
VDAC2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16980-CF
VDAC2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16980-NF
VDAC2 cDNA ORF Clone, Human, C-His tag HG16980-CH
VDAC2 cDNA ORF Clone, Human, N-His tag HG16980-NH
VDAC2 cDNA ORF Clone, Human, C-HA tag HG16980-CY
VDAC2 cDNA ORF Clone, Human, N-HA tag HG16980-NY
VDAC2 cDNA ORF Clone, Human, C-Myc tag HG16980-CM
VDAC2 cDNA ORF Clone, Human, N-Myc tag HG16980-NM
info info
添加购物车成功! 添加购物车失败!