UQCRC2 cDNA ORF Clone, Rat, N-Myc tag

Cat: RG80884-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All UQCRC2 Reagents
CRO Services
Product recommended

All UQCRC2 Reagents
UQCRC2 cDNA ORF Clone, Rat, N-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1359 bp
Description
Full length Clone DNA of Rat ubiquinol cytochrome c reductase core protein 2 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

UQCRC2 Background Information
Full Name
ubiquinol-cytochrome c reductase core protein II

UQCRC2 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
UQCRC2 cDNA ORF Clone in Cloning Vector, Rhesus CG90393-G
UQCRC2 cDNA ORF Clone, Rhesus, untagged CG90393-UT
UQCRC2 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90393-ACGLN
UQCRC2 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90393-ACG
UQCRC2 cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90393-ANG
UQCRC2 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90393-ACR
UQCRC2 cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90393-ANR
UQCRC2 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90393-CF
UQCRC2 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90393-NF
UQCRC2 cDNA ORF Clone, Rhesus, C-His tag CG90393-CH
UQCRC2 cDNA ORF Clone, Rhesus, N-His tag CG90393-NH
UQCRC2 cDNA ORF Clone, Rhesus, C-HA tag CG90393-CY
UQCRC2 cDNA ORF Clone, Rhesus, N-HA tag CG90393-NY
UQCRC2 cDNA ORF Clone, Rhesus, C-Myc tag CG90393-CM
UQCRC2 cDNA ORF Clone, Rhesus, N-Myc tag CG90393-NM

UQCRC2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
UQCRC2 cDNA ORF Clone in Cloning Vector, Rat RG80884-U
UQCRC2 cDNA ORF Clone, Rat, untagged RG80884-UT
UQCRC2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80884-ACG
UQCRC2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80884-ACGLN
UQCRC2 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80884-ANG
UQCRC2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80884-ACR
UQCRC2 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80884-ANR
UQCRC2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80884-CF
UQCRC2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80884-NF
UQCRC2 cDNA ORF Clone, Rat, C-His tag RG80884-CH
UQCRC2 cDNA ORF Clone, Rat, N-His tag RG80884-NH
UQCRC2 cDNA ORF Clone, Rat, C-HA tag RG80884-CY
UQCRC2 cDNA ORF Clone, Rat, N-HA tag RG80884-NY
UQCRC2 cDNA ORF Clone, Rat, C-Myc tag RG80884-CM
UQCRC2 qPCR Primer Pairs, Rat RP300848

UQCRC2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
UQCRC2 cDNA ORF Clone in Cloning Vector, Mouse MG51539-U
UQCRC2 cDNA ORF Clone, Mouse, untagged MG51539-UT
UQCRC2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51539-ACG
UQCRC2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51539-ACGLN
UQCRC2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51539-ANG
UQCRC2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51539-ACR
UQCRC2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51539-ANR
UQCRC2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51539-CF
UQCRC2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51539-NF
UQCRC2 cDNA ORF Clone, Mouse, C-His tag MG51539-CH
UQCRC2 cDNA ORF Clone, Mouse, N-His tag MG51539-NH
UQCRC2 cDNA ORF Clone, Mouse, C-HA tag MG51539-CY
UQCRC2 cDNA ORF Clone, Mouse, N-HA tag MG51539-NY
UQCRC2 cDNA ORF Clone, Mouse, C-Myc tag MG51539-CM
UQCRC2 cDNA ORF Clone, Mouse, N-Myc tag MG51539-NM
UQCRC2 qPCR Primer Pairs, Mouse MP201423

UQCRC2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
UQCRC2 cDNA ORF Clone in Cloning Vector, Human HG16321-G
UQCRC2 cDNA ORF Clone, Human, untagged HG16321-UT
UQCRC2 cDNA ORF Clone, Human, C-GFPSpark® tag HG16321-ACG
UQCRC2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16321-ACGLN
UQCRC2 cDNA ORF Clone, Human, N-GFPSpark® tag HG16321-ANG
UQCRC2 cDNA ORF Clone, Human, C-OFPSpark® tag HG16321-ACR
UQCRC2 cDNA ORF Clone, Human, N-OFPSpark® tag HG16321-ANR
UQCRC2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16321-CF
UQCRC2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16321-NF
UQCRC2 cDNA ORF Clone, Human, C-His tag HG16321-CH
UQCRC2 cDNA ORF Clone, Human, N-His tag HG16321-NH
UQCRC2 cDNA ORF Clone, Human, C-HA tag HG16321-CY
UQCRC2 cDNA ORF Clone, Human, N-HA tag HG16321-NY
UQCRC2 cDNA ORF Clone, Human, C-Myc tag HG16321-CM
UQCRC2 cDNA ORF Clone, Human, N-Myc tag HG16321-NM
UQCRC2 qPCR Primer Pairs, Human HP105075
info info
添加购物车成功! 添加购物车失败!