UPK1B cDNA ORF Clone, Rat, C-DDK (Flag®) tag

Cat: RG81171-CF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All UPK1B Reagents
CRO Services
Product recommended

All UPK1B Reagents
UPK1B cDNA ORF Clone, Rat, C-DDK (Flag®) tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
783 bp
Description
Full length Clone DNA of Rat uroplakin 1B with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

UPK1B Background Information
Full Name
uroplakin 1B

UPK1B cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
UPK1B cDNA ORF Clone in Cloning Vector, Rat RG81171-U
UPK1B cDNA ORF Clone, Rat, untagged RG81171-UT
UPK1B cDNA ORF Clone, Rat, C-GFPSpark® tag RG81171-ACG
UPK1B Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81171-ACGLN
UPK1B cDNA ORF Clone, Rat, C-OFPSpark® tag RG81171-ACR
UPK1B cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81171-NF
UPK1B cDNA ORF Clone, Rat, C-His tag RG81171-CH
UPK1B cDNA ORF Clone, Rat, N-His tag RG81171-NH
UPK1B cDNA ORF Clone, Rat, C-HA tag RG81171-CY
UPK1B cDNA ORF Clone, Rat, N-HA tag RG81171-NY
UPK1B cDNA ORF Clone, Rat, C-Myc tag RG81171-CM
UPK1B cDNA ORF Clone, Rat, N-Myc tag RG81171-NM
UPK1B qPCR Primer Pairs, Rat RP301127

UPK1B cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
UPK1B cDNA ORF Clone in Cloning Vector, Human HG15247-G
UPK1B cDNA ORF Clone, Human, untagged HG15247-UT
UPK1B Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15247-ACGLN
UPK1B cDNA ORF Clone, Human, C-GFPSpark® tag HG15247-ACG
UPK1B cDNA ORF Clone, Human, C-OFPSpark® tag HG15247-ACR
UPK1B cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15247-CF
UPK1B cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15247-NF
UPK1B cDNA ORF Clone, Human, C-His tag HG15247-CH
UPK1B cDNA ORF Clone, Human, N-His tag HG15247-NH
UPK1B cDNA ORF Clone, Human, C-HA tag HG15247-CY
UPK1B cDNA ORF Clone, Human, N-HA tag HG15247-NY
UPK1B cDNA ORF Clone, Human, C-Myc tag HG15247-CM
UPK1B cDNA ORF Clone, Human, N-Myc tag HG15247-NM
UPK1B qPCR Primer Pairs, Human HP103873
info info
添加购物车成功! 添加购物车失败!