UNC5B cDNA ORF Clone, Rat, C-DDK (Flag®) tag

Cat: RG80065-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All UNC5B Reagents
CRO Services
Product recommended

All UNC5B Reagents
UNC5B cDNA ORF Clone, Rat, C-DDK (Flag®) tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
2838 bp
Description
Full length Clone DNA of Rat unc-5 homolog B (C. elegans) with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

UNC5B Background Information
Full Name
unc-5 homolog B (C. elegans)

UNC5B cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
UNC5B cDNA ORF Clone in Cloning Vector, Rat RG80065-M
UNC5B cDNA ORF Clone, Rat, untagged RG80065-UT
UNC5B Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80065-ACGLN
UNC5B cDNA ORF Clone, Rat, C-GFPSpark® tag RG80065-ACG
UNC5B cDNA ORF Clone, Rat, C-OFPSpark® tag RG80065-ACR
UNC5B cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80065-NF
UNC5B cDNA ORF Clone, Rat, C-His tag RG80065-CH
UNC5B cDNA ORF Clone, Rat, N-His tag RG80065-NH
UNC5B cDNA ORF Clone, Rat, C-HA tag RG80065-CY
UNC5B cDNA ORF Clone, Rat, N-HA tag RG80065-NY
UNC5B cDNA ORF Clone, Rat, C-Myc tag RG80065-CM
UNC5B cDNA ORF Clone, Rat, N-Myc tag RG80065-NM
UNC5B qPCR Primer Pairs, Rat RP300063

UNC5B cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
UNC5B cDNA ORF Clone in Cloning Vector, Human HG13606-G
UNC5B cDNA ORF Clone, Human, untagged HG13606-UT
UNC5B cDNA ORF Clone, Human, C-GFPSpark® tag HG13606-ACG
UNC5B Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13606-ACGLN
UNC5B cDNA ORF Clone, Human, C-OFPSpark® tag HG13606-ACR
UNC5B cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13606-CF
UNC5B cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13606-NF
UNC5B cDNA ORF Clone, Human, C-His tag HG13606-CH
UNC5B cDNA ORF Clone, Human, N-His tag HG13606-NH
UNC5B cDNA ORF Clone, Human, C-HA tag HG13606-CY
UNC5B cDNA ORF Clone, Human, N-HA tag HG13606-NY
UNC5B cDNA ORF Clone, Human, C-Myc tag HG13606-CM
UNC5B cDNA ORF Clone, Human, N-Myc tag HG13606-NM
UNC5B qPCR Primer Pairs, Human HP102291
info info
添加购物车成功! 添加购物车失败!