UFD1L cDNA ORF Clone, Rat, N-Myc tag

Cat: RG80873-NM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All UFD1L Reagents
CRO Services
Product recommended

All UFD1L Reagents
UFD1L cDNA ORF Clone, Rat, N-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
924 bp
Description
Full length Clone DNA of Rat ubiquitin fusion degradation 1 like (yeast) with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

UFD1L Background Information
Full Name
ubiquitin fusion degradation 1 like (yeast)

UFD1L cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
UFD1L cDNA ORF Clone in Cloning Vector, Rat RG80873-U
UFD1L cDNA ORF Clone, Rat, untagged RG80873-UT
UFD1L Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80873-ACGLN
UFD1L cDNA ORF Clone, Rat, C-GFPSpark® tag RG80873-ACG
UFD1L cDNA ORF Clone, Rat, N-GFPSpark® tag RG80873-ANG
UFD1L cDNA ORF Clone, Rat, C-OFPSpark® tag RG80873-ACR
UFD1L cDNA ORF Clone, Rat, N-OFPSpark® tag RG80873-ANR
UFD1L cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80873-CF
UFD1L cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80873-NF
UFD1L cDNA ORF Clone, Rat, C-His tag RG80873-CH
UFD1L cDNA ORF Clone, Rat, N-His tag RG80873-NH
UFD1L cDNA ORF Clone, Rat, C-HA tag RG80873-CY
UFD1L cDNA ORF Clone, Rat, N-HA tag RG80873-NY
UFD1L cDNA ORF Clone, Rat, C-Myc tag RG80873-CM
UFD1L qPCR Primer Pairs, Rat RP300837

UFD1L cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
UFD1L cDNA ORF Clone in Cloning Vector, Mouse MG51597-U
UFD1L cDNA ORF Clone, Mouse, untagged MG51597-UT
UFD1L Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51597-ACGLN
UFD1L cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51597-ACG
UFD1L cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51597-ANG
UFD1L cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51597-ACR
UFD1L cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51597-ANR
UFD1L cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51597-CF
UFD1L cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51597-NF
UFD1L cDNA ORF Clone, Mouse, C-His tag MG51597-CH
UFD1L cDNA ORF Clone, Mouse, N-His tag MG51597-NH
UFD1L cDNA ORF Clone, Mouse, C-HA tag MG51597-CY
UFD1L cDNA ORF Clone, Mouse, N-HA tag MG51597-NY
UFD1L cDNA ORF Clone, Mouse, C-Myc tag MG51597-CM
UFD1L cDNA ORF Clone, Mouse, N-Myc tag MG51597-NM
UFD1L qPCR Primer Pairs, Mouse MP201480

UFD1L cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
UFD1L cDNA ORF Clone in Cloning Vector, Human HG16509-G
UFD1L cDNA ORF Clone, Human, untagged HG16509-UT
UFD1L cDNA ORF Clone, Human, C-GFPSpark® tag HG16509-ACG
UFD1L Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16509-ACGLN
UFD1L cDNA ORF Clone, Human, N-GFPSpark® tag HG16509-ANG
UFD1L cDNA ORF Clone, Human, C-OFPSpark® tag HG16509-ACR
UFD1L cDNA ORF Clone, Human, N-OFPSpark® tag HG16509-ANR
UFD1L cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16509-CF
UFD1L cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16509-NF
UFD1L cDNA ORF Clone, Human, C-His tag HG16509-CH
UFD1L cDNA ORF Clone, Human, N-His tag HG16509-NH
UFD1L cDNA ORF Clone, Human, C-HA tag HG16509-CY
UFD1L cDNA ORF Clone, Human, N-HA tag HG16509-NY
UFD1L cDNA ORF Clone, Human, C-Myc tag HG16509-CM
UFD1L cDNA ORF Clone, Human, N-Myc tag HG16509-NM
info info
添加购物车成功! 添加购物车失败!