UBOX5 cDNA ORF Clone, Rat, N-Myc tag

Cat: RG80868-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All UBOX5 Reagents
CRO Services
Product recommended

All UBOX5 Reagents
UBOX5 cDNA ORF Clone, Rat, N-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1617 bp
Description
Full length Clone DNA of Rat U-box domain containing 5 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

UBOX5 Background Information
Full Name
U-box domain containing 5

UBOX5 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
UBOX5 cDNA ORF Clone in Cloning Vector, Rat RG80868-U
UBOX5 cDNA ORF Clone, Rat, untagged RG80868-UT
UBOX5 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80868-ACGLN
UBOX5 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80868-ACG
UBOX5 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80868-ANG
UBOX5 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80868-ACR
UBOX5 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80868-ANR
UBOX5 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80868-CF
UBOX5 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80868-NF
UBOX5 cDNA ORF Clone, Rat, C-His tag RG80868-CH
UBOX5 cDNA ORF Clone, Rat, N-His tag RG80868-NH
UBOX5 cDNA ORF Clone, Rat, C-HA tag RG80868-CY
UBOX5 cDNA ORF Clone, Rat, N-HA tag RG80868-NY
UBOX5 cDNA ORF Clone, Rat, C-Myc tag RG80868-CM
UBOX5 qPCR Primer Pairs, Rat RP300832

UBOX5 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
UBOX5 cDNA ORF Clone in Cloning Vector, Mouse MG53091-G
UBOX5 cDNA ORF Clone, Mouse, untagged MG53091-UT
UBOX5 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53091-ACG
UBOX5 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53091-ACGLN
UBOX5 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53091-ANG
UBOX5 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53091-ACR
UBOX5 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53091-ANR
UBOX5 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53091-CF
UBOX5 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53091-NF
UBOX5 cDNA ORF Clone, Mouse, C-His tag MG53091-CH
UBOX5 cDNA ORF Clone, Mouse, N-His tag MG53091-NH
UBOX5 cDNA ORF Clone, Mouse, C-HA tag MG53091-CY
UBOX5 cDNA ORF Clone, Mouse, N-HA tag MG53091-NY
UBOX5 cDNA ORF Clone, Mouse, C-Myc tag MG53091-CM
UBOX5 cDNA ORF Clone, Mouse, N-Myc tag MG53091-NM

UBOX5 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
UBOX5 cDNA ORF Clone in Cloning Vector, Human HG23680-U
info info
添加购物车成功! 添加购物车失败!