Quick Order

Rat UBE2I Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Rat UBE2I cDNA Clone Product Information
NCBI RefSeq:NM_013050.1
RefSeq ORF Size:477bp
cDNA Description:Full length Clone DNA of Rattus norvegicus ubiquitin-conjugating enzyme E2I.
Gene Synonym:UbcE2A
Species:Rat
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

UBE2I is a member of the ubiquitin-conjugating E2 family whose members perform the second step in the ubiquitination reaction. Initially identified as the main process for protein degradation, ubiquitination is believed nowadays to be crucial for a wider range of cellular processes. The outcome of the ubiquitin-conjugation reaction, and thereby the fate of the substrate, is heavily dependent on the number of ubiquitin molecules attached and how these ubiquitin molecules are inter-connected. To deal with this complexity and to allow adequate ubiquitination in time and space, a highly sophisticated conjugation machinery has been developed. In a sequential manner, ubiquitin becomes activated by an ubiquitin-activating enzyme (E1), which then transfers the ubiquitin to a group of ubiquitin-conjugating enzymes (E2s). Next, ubiquitin-loaded E2s are interacting with ubiquitin protein ligases (E3s) and ubiquitin is conjugated to substrates on recruitment by the E3. These three key enzymes are operating in a hierarchical system, wherein two E1s and 35 E2s have been found and hundreds of E3s have been identified in humans. 

References
  • Sjoerd J L van Wijk, et al. (2009) A comprehensive framework of E2-RING E3 interactions of the human ubiquitin-proteasome system. Mol Syst Biol. 5: 317.
  • Nandi D, et al. (2006) The ubiquitin-proteasome system. Journal of biosciences. 31 (1): 137-55.
  • Size / Price
    Catalog: RG81167-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"