UBB cDNA ORF Clone, Rat, N-HA tag

Cat: RG80692-NY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All UBB Reagents
CRO Services
Product recommended

All UBB Reagents
UBB cDNA ORF Clone, Rat, N-HA tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
918 bp
Description
Full length Clone DNA of Rat ubiquitin B with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

UBB Background Information
Full Name
ubiquitin B

UBB cDNA ORF Clone, Rabbit, Related Products

Product Name Catalog#(PDF)
UBB cDNA ORF Clone in Cloning Vector, Rabbit TG65139-G
UBB cDNA ORF Clone, Rabbit, untagged TG65139-UT
UBB Lentiviral cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65139-ACGLN
UBB cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65139-ACG
UBB cDNA ORF Clone, Rabbit, N-GFPSpark® tag TG65139-ANG
UBB cDNA ORF Clone, Rabbit, C-OFPSpark® tag TG65139-ACR
UBB cDNA ORF Clone, Rabbit, N-OFPSpark® tag TG65139-ANR
UBB cDNA ORF Clone, Rabbit, C-DDK (Flag®) tag TG65139-CF
UBB cDNA ORF Clone, Rabbit, N-DDK (Flag®) tag TG65139-NF
UBB cDNA ORF Clone, Rabbit, C-His tag TG65139-CH
UBB cDNA ORF Clone, Rabbit, N-His tag TG65139-NH
UBB cDNA ORF Clone, Rabbit, C-HA tag TG65139-CY
UBB cDNA ORF Clone, Rabbit, N-HA tag TG65139-NY
UBB cDNA ORF Clone, Rabbit, C-Myc tag TG65139-CM
UBB cDNA ORF Clone, Rabbit, N-Myc tag TG65139-NM

UBB cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
UBB cDNA ORF Clone in Cloning Vector, Rat RG80692-U
UBB cDNA ORF Clone, Rat, untagged RG80692-UT
UBB Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80692-ACGLN
UBB cDNA ORF Clone, Rat, C-GFPSpark® tag RG80692-ACG
UBB cDNA ORF Clone, Rat, N-GFPSpark® tag RG80692-ANG
UBB cDNA ORF Clone, Rat, C-OFPSpark® tag RG80692-ACR
UBB cDNA ORF Clone, Rat, N-OFPSpark® tag RG80692-ANR
UBB cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80692-CF
UBB cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80692-NF
UBB cDNA ORF Clone, Rat, C-His tag RG80692-CH
UBB cDNA ORF Clone, Rat, N-His tag RG80692-NH
UBB cDNA ORF Clone, Rat, C-HA tag RG80692-CY
UBB cDNA ORF Clone, Rat, C-Myc tag RG80692-CM
UBB cDNA ORF Clone, Rat, N-Myc tag RG80692-NM
UBB qPCR Primer Pairs, Rat RP300656

UBB cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
UBB cDNA ORF Clone in Cloning Vector, Mouse MG51353-U
UBB cDNA ORF Clone, Mouse, untagged MG51353-UT
UBB cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51353-ACG
UBB Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51353-ACGLN
UBB cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51353-ANG
UBB cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51353-ACR
UBB cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51353-ANR
UBB cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51353-CF
UBB cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51353-NF
UBB cDNA ORF Clone, Mouse, C-His tag MG51353-CH
UBB cDNA ORF Clone, Mouse, N-His tag MG51353-NH
UBB cDNA ORF Clone, Mouse, C-HA tag MG51353-CY
UBB cDNA ORF Clone, Mouse, N-HA tag MG51353-NY
UBB cDNA ORF Clone, Mouse, C-Myc tag MG51353-CM
UBB cDNA ORF Clone, Mouse, N-Myc tag MG51353-NM
UBB qPCR Primer Pairs, Mouse MP201230

UBB cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
UBB cDNA ORF Clone in Cloning Vector, Human HG16831-U
UBB Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16831-ACGLN
UBB cDNA ORF Clone, Human, N-HA tag HG16831-NY
info info
添加购物车成功! 添加购物车失败!