Thrombopoietin cDNA ORF Clone, Rat, C-DDK (Flag®) tag

Cat: RG80081-CF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Thrombopoietin Reagents
CRO Services
Product recommended

All Thrombopoietin Reagents
Thrombopoietin cDNA ORF Clone, Rat, C-DDK (Flag®) tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
981 bp
Description
Full length Clone DNA of Rat thrombopoietin with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Thrombopoietin Background Information

Thrombopoietin (TPO or THPO), also known as myeloproliferative leukemia virus ligand (c-Mpl), is a hematopoietic growth factor belonging to the EPO/TPO family. The thrombopoietin protein is produced mainly by the liver and the kidney that regulates the production of platelets by the bone marrow. Thrombopoietin protein stimulates both proliferation of progenitor megakaryocytes and their maturation to platelet-producing megakaryocytes, and also accelerates the recovery of platelets. Thrombopoietin protein is involved in cardiovascular disease as it regulates megakaryocyte development and enhances platelet adhesion/aggregation. It has been identified that surface c-MPL, the receptor for thrombopoietin protein, binds to the ligand and mediates the action.

Full Name
thrombopoietin
References
  • Ryu T,et al.(2003) Thrombopoietin-producing hepatocellular carcinoma. Intern Med. 42(8): 730-4.
  • Higashihara M,et al. (2003) Thrombopoietin-producing tumor. Intern Med. 42(8): 632-3?
  • Thrombopoietin cDNA ORF Clone, Cynomolgus, Related Products

    Product Name Catalog#(PDF)
    Thrombopoietin cDNA ORF Clone in Cloning Vector, Cynomolgus CG90004-G
    Thrombopoietin cDNA ORF Clone, Cynomolgus, untagged CG90004-UT
    Thrombopoietin Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90004-ACGLN
    Thrombopoietin cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90004-ACG
    Thrombopoietin cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90004-ACR
    Thrombopoietin cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90004-CF
    Thrombopoietin cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90004-NF
    Thrombopoietin cDNA ORF Clone, Cynomolgus, C-His tag CG90004-CH
    Thrombopoietin cDNA ORF Clone, Cynomolgus, N-His tag CG90004-NH
    Thrombopoietin cDNA ORF Clone, Cynomolgus, C-HA tag CG90004-CY
    Thrombopoietin cDNA ORF Clone, Cynomolgus, N-HA tag CG90004-NY
    Thrombopoietin cDNA ORF Clone, Cynomolgus, C-Myc tag CG90004-CM
    Thrombopoietin cDNA ORF Clone, Cynomolgus, N-Myc tag CG90004-NM

    Thrombopoietin cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Thrombopoietin cDNA ORF Clone in Cloning Vector, Rat RG80081-M
    Thrombopoietin cDNA ORF Clone, Rat, untagged RG80081-UT
    Thrombopoietin Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80081-ACGLN
    Thrombopoietin cDNA ORF Clone, Rat, C-GFPSpark® tag RG80081-ACG
    Thrombopoietin cDNA ORF Clone, Rat, C-OFPSpark® tag RG80081-ACR
    Thrombopoietin cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80081-NF
    Thrombopoietin cDNA ORF Clone, Rat, C-His tag RG80081-CH
    Thrombopoietin cDNA ORF Clone, Rat, N-His tag RG80081-NH
    Thrombopoietin cDNA ORF Clone, Rat, C-HA tag RG80081-CY
    Thrombopoietin cDNA ORF Clone, Rat, N-HA tag RG80081-NY
    Thrombopoietin cDNA ORF Clone, Rat, C-Myc tag RG80081-CM
    Thrombopoietin cDNA ORF Clone, Rat, N-Myc tag RG80081-NM
    Thrombopoietin qPCR Primer Pairs, Rat RP300077

    Thrombopoietin cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Thrombopoietin cDNA ORF Clone in Cloning Vector, Mouse MG50146-M
    Thrombopoietin cDNA ORF Clone, Mouse, untagged MG50146-UT
    Thrombopoietin Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50146-ACGLN
    Thrombopoietin cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50146-ACG
    Thrombopoietin cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50146-ACR
    Thrombopoietin cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50146-CF
    Thrombopoietin cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50146-NF
    Thrombopoietin cDNA ORF Clone, Mouse, C-His tag MG50146-CH
    Thrombopoietin cDNA ORF Clone, Mouse, N-His tag MG50146-NH
    Thrombopoietin cDNA ORF Clone, Mouse, C-HA tag MG50146-CY
    Thrombopoietin cDNA ORF Clone, Mouse, N-HA tag MG50146-NY
    Thrombopoietin cDNA ORF Clone, Mouse, C-Myc tag MG50146-CM
    Thrombopoietin cDNA ORF Clone, Mouse, N-Myc tag MG50146-NM
    Thrombopoietin qPCR Primer Pairs, Mouse MP200176

    Thrombopoietin cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Thrombopoietin cDNA ORF Clone in Cloning Vector, Human HG10381-M
    Thrombopoietin cDNA ORF Clone, Human, untagged HG10381-UT
    Thrombopoietin Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10381-ACGLN
    Thrombopoietin cDNA ORF Clone, Human, C-GFPSpark® tag HG10381-ACG
    Thrombopoietin cDNA ORF Clone, Human, C-OFPSpark® tag HG10381-ACR
    Thrombopoietin cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10381-CF
    Thrombopoietin cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10381-NF
    Thrombopoietin cDNA ORF Clone, Human, C-His tag HG10381-CH
    Thrombopoietin cDNA ORF Clone, Human, N-His tag HG10381-NH
    Thrombopoietin cDNA ORF Clone, Human, C-HA tag HG10381-CY
    Thrombopoietin cDNA ORF Clone, Human, N-HA tag HG10381-NY
    Thrombopoietin cDNA ORF Clone, Human, C-Myc tag HG10381-CM
    Thrombopoietin cDNA ORF Clone, Human, N-Myc tag HG10381-NM
    Thrombopoietin qPCR Primer Pairs, Human HP100415
    info info
    添加购物车成功! 添加购物车失败!