TYW1 cDNA ORF Clone, Rat, untagged

Cat: RG81065-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All TYW1 Reagents
CRO Services
Product recommended

All TYW1 Reagents
TYW1 cDNA ORF Clone, Rat, untagged General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
2175 bp
Description
Full length Clone DNA of Rat tRNA-yW synthesizing protein 1 homolog (S. cerevisiae).
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TYW1 Background Information
Full Name
tRNA-yW synthesizing protein 1 homolog

TYW1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
TYW1 cDNA ORF Clone in Cloning Vector, Rat RG81065-U
TYW1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81065-ACG
TYW1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81065-ACGLN
TYW1 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81065-ANG
TYW1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81065-ACR
TYW1 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81065-ANR
TYW1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81065-CF
TYW1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81065-NF
TYW1 cDNA ORF Clone, Rat, C-His tag RG81065-CH
TYW1 cDNA ORF Clone, Rat, N-His tag RG81065-NH
TYW1 cDNA ORF Clone, Rat, C-HA tag RG81065-CY
TYW1 cDNA ORF Clone, Rat, N-HA tag RG81065-NY
TYW1 cDNA ORF Clone, Rat, C-Myc tag RG81065-CM
TYW1 cDNA ORF Clone, Rat, N-Myc tag RG81065-NM
TYW1 qPCR Primer Pairs, Rat RP301029

TYW1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TYW1 cDNA ORF Clone in Cloning Vector, Mouse MG5A6479-U
TYW1 cDNA ORF Clone, Mouse, untagged MG5A6479-UT
TYW1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A6479-ACG
TYW1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A6479-ACGLN
TYW1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A6479-ANG
TYW1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A6479-ACR
TYW1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A6479-ANR
TYW1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A6479-CF
TYW1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A6479-NF
TYW1 cDNA ORF Clone, Mouse, C-His tag MG5A6479-CH
TYW1 cDNA ORF Clone, Mouse, N-His tag MG5A6479-NH
TYW1 cDNA ORF Clone, Mouse, C-HA tag MG5A6479-CY
TYW1 cDNA ORF Clone, Mouse, N-HA tag MG5A6479-NY
TYW1 cDNA ORF Clone, Mouse, C-Myc tag MG5A6479-CM
TYW1 cDNA ORF Clone, Mouse, N-Myc tag MG5A6479-NM
info info
添加购物车成功! 添加购物车失败!