TUFM cDNA ORF Clone, Rat, N-His tag

Cat: RG80655-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All TUFM Reagents
CRO Services
Product recommended

All TUFM Reagents
TUFM cDNA ORF Clone, Rat, N-His tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1359 bp
Description
Full length Clone DNA of Rat Tu translation elongation factor, mitochondrial with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TUFM Background Information
Full Name
Tu translation elongation factor, mitochondrial

TUFM cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
TUFM cDNA ORF Clone in Cloning Vector, Rat RG80655-U
TUFM cDNA ORF Clone, Rat, untagged RG80655-UT
TUFM cDNA ORF Clone, Rat, C-GFPSpark® tag RG80655-ACG
TUFM Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80655-ACGLN
TUFM cDNA ORF Clone, Rat, N-GFPSpark® tag RG80655-ANG
TUFM cDNA ORF Clone, Rat, C-OFPSpark® tag RG80655-ACR
TUFM cDNA ORF Clone, Rat, N-OFPSpark® tag RG80655-ANR
TUFM cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80655-CF
TUFM cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80655-NF
TUFM cDNA ORF Clone, Rat, C-His tag RG80655-CH
TUFM cDNA ORF Clone, Rat, C-HA tag RG80655-CY
TUFM cDNA ORF Clone, Rat, N-HA tag RG80655-NY
TUFM cDNA ORF Clone, Rat, C-Myc tag RG80655-CM
TUFM cDNA ORF Clone, Rat, N-Myc tag RG80655-NM
TUFM qPCR Primer Pairs, Rat RP300619

TUFM cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TUFM cDNA ORF Clone in Cloning Vector, Mouse MG53653-U
TUFM cDNA ORF Clone, Mouse, untagged MG53653-UT
TUFM Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53653-ACGLN
TUFM cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53653-ACG
TUFM cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53653-ANG
TUFM cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53653-ACR
TUFM cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53653-ANR
TUFM cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53653-CF
TUFM cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53653-NF
TUFM cDNA ORF Clone, Mouse, C-His tag MG53653-CH
TUFM cDNA ORF Clone, Mouse, N-His tag MG53653-NH
TUFM cDNA ORF Clone, Mouse, C-HA tag MG53653-CY
TUFM cDNA ORF Clone, Mouse, N-HA tag MG53653-NY
TUFM cDNA ORF Clone, Mouse, C-Myc tag MG53653-CM
TUFM cDNA ORF Clone, Mouse, N-Myc tag MG53653-NM

TUFM cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TUFM cDNA ORF Clone in Cloning Vector, Human HG16801-U
TUFM cDNA ORF Clone, Human, untagged HG16801-UT
TUFM Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16801-ACGLN
TUFM cDNA ORF Clone, Human, C-GFPSpark® tag HG16801-ACG
TUFM cDNA ORF Clone, Human, N-GFPSpark® tag HG16801-ANG
TUFM cDNA ORF Clone, Human, C-OFPSpark® tag HG16801-ACR
TUFM cDNA ORF Clone, Human, N-OFPSpark® tag HG16801-ANR
TUFM cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16801-CF
TUFM cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16801-NF
TUFM cDNA ORF Clone, Human, C-His tag HG16801-CH
TUFM cDNA ORF Clone, Human, N-His tag HG16801-NH
TUFM cDNA ORF Clone, Human, C-HA tag HG16801-CY
TUFM cDNA ORF Clone, Human, N-HA tag HG16801-NY
TUFM cDNA ORF Clone, Human, C-Myc tag HG16801-CM
TUFM cDNA ORF Clone, Human, N-Myc tag HG16801-NM
info info
添加购物车成功! 添加购物车失败!