TUBB5 cDNA ORF Clone, Rat, C-HA tag

Cat: RG80682-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All TUBB5 Reagents
CRO Services
Product recommended

All TUBB5 Reagents
TUBB5 cDNA ORF Clone, Rat, C-HA tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1335 bp
Description
Full length Clone DNA of Rat tubulin, beta 5 class I with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TUBB5 Background Information
Full Name
tubulin, beta 5 class I

TUBB5 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
TUBB5 cDNA ORF Clone in Cloning Vector, Rat RG80682-U
TUBB5 cDNA ORF Clone, Rat, untagged RG80682-UT
TUBB5 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80682-ACGLN
TUBB5 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80682-ACG
TUBB5 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80682-ANG
TUBB5 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80682-ACR
TUBB5 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80682-ANR
TUBB5 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80682-CF
TUBB5 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80682-NF
TUBB5 cDNA ORF Clone, Rat, C-His tag RG80682-CH
TUBB5 cDNA ORF Clone, Rat, N-His tag RG80682-NH
TUBB5 cDNA ORF Clone, Rat, N-HA tag RG80682-NY
TUBB5 cDNA ORF Clone, Rat, C-Myc tag RG80682-CM
TUBB5 cDNA ORF Clone, Rat, N-Myc tag RG80682-NM
TUBB5 qPCR Primer Pairs, Rat RP300646

TUBB5 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TUBB5 cDNA ORF Clone in Cloning Vector, Mouse MG52582-G
TUBB5 cDNA ORF Clone, Mouse, untagged MG52582-UT
TUBB5 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52582-ACG
TUBB5 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52582-ACGLN
TUBB5 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52582-ANG
TUBB5 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52582-ACR
TUBB5 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52582-ANR
TUBB5 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52582-CF
TUBB5 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52582-NF
TUBB5 cDNA ORF Clone, Mouse, C-His tag MG52582-CH
TUBB5 cDNA ORF Clone, Mouse, N-His tag MG52582-NH
TUBB5 cDNA ORF Clone, Mouse, C-HA tag MG52582-CY
TUBB5 cDNA ORF Clone, Mouse, N-HA tag MG52582-NY
TUBB5 cDNA ORF Clone, Mouse, C-Myc tag MG52582-CM
TUBB5 cDNA ORF Clone, Mouse, N-Myc tag MG52582-NM
TUBB5 qPCR Primer Pairs, Mouse MP202453
info info
添加购物车成功! 添加购物车失败!