TUBA1C cDNA ORF Clone, Rat, C-His tag

Cat: RG81079-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All TUBA1C Reagents
CRO Services
Product recommended

All TUBA1C Reagents
TUBA1C cDNA ORF Clone, Rat, C-His tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1350 bp
Description
Full length Clone DNA of Rat tubulin, alpha 1C with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TUBA1C Background Information
Full Name
tubulin, alpha 1c

TUBA1C cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
TUBA1C cDNA ORF Clone in Cloning Vector, Rat RG81079-U
TUBA1C cDNA ORF Clone, Rat, untagged RG81079-UT
TUBA1C cDNA ORF Clone, Rat, C-GFPSpark® tag RG81079-ACG
TUBA1C Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81079-ACGLN
TUBA1C cDNA ORF Clone, Rat, N-GFPSpark® tag RG81079-ANG
TUBA1C cDNA ORF Clone, Rat, C-OFPSpark® tag RG81079-ACR
TUBA1C cDNA ORF Clone, Rat, N-OFPSpark® tag RG81079-ANR
TUBA1C cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81079-CF
TUBA1C cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81079-NF
TUBA1C cDNA ORF Clone, Rat, N-His tag RG81079-NH
TUBA1C cDNA ORF Clone, Rat, C-HA tag RG81079-CY
TUBA1C cDNA ORF Clone, Rat, N-HA tag RG81079-NY
TUBA1C cDNA ORF Clone, Rat, C-Myc tag RG81079-CM
TUBA1C cDNA ORF Clone, Rat, N-Myc tag RG81079-NM
TUBA1C qPCR Primer Pairs, Rat RP301036

TUBA1C cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TUBA1C cDNA ORF Clone in Cloning Vector, Mouse MG5A3028-U
TUBA1C cDNA ORF Clone, Mouse, untagged MG5A3028-UT
TUBA1C Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A3028-ACGLN
TUBA1C cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A3028-ACG
TUBA1C cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A3028-ANG
TUBA1C cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A3028-ACR
TUBA1C cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A3028-ANR
TUBA1C cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A3028-CF
TUBA1C cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A3028-NF
TUBA1C cDNA ORF Clone, Mouse, C-His tag MG5A3028-CH
TUBA1C cDNA ORF Clone, Mouse, N-His tag MG5A3028-NH
TUBA1C cDNA ORF Clone, Mouse, C-HA tag MG5A3028-CY
TUBA1C cDNA ORF Clone, Mouse, N-HA tag MG5A3028-NY
TUBA1C cDNA ORF Clone, Mouse, C-Myc tag MG5A3028-CM
TUBA1C cDNA ORF Clone, Mouse, N-Myc tag MG5A3028-NM

TUBA1C cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TUBA1C cDNA ORF Clone in Cloning Vector, Human HG14068-G
TUBA1C cDNA ORF Clone, Human, untagged HG14068-UT
TUBA1C Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14068-ACGLN
TUBA1C cDNA ORF Clone, Human, C-GFPSpark® tag HG14068-ACG
TUBA1C cDNA ORF Clone, Human, N-GFPSpark® tag HG14068-ANG
TUBA1C cDNA ORF Clone, Human, C-OFPSpark® tag HG14068-ACR
TUBA1C cDNA ORF Clone, Human, N-OFPSpark® tag HG14068-ANR
TUBA1C cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14068-CF
TUBA1C cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14068-NF
TUBA1C cDNA ORF Clone, Human, C-His tag HG14068-CH
TUBA1C cDNA ORF Clone, Human, N-His tag HG14068-NH
TUBA1C cDNA ORF Clone, Human, C-HA tag HG14068-CY
TUBA1C cDNA ORF Clone, Human, N-HA tag HG14068-NY
TUBA1C cDNA ORF Clone, Human, C-Myc tag HG14068-CM
TUBA1C cDNA ORF Clone, Human, N-Myc tag HG14068-NM
TUBA1C qPCR Primer Pairs, Human HP102571
info info
添加购物车成功! 添加购物车失败!