TST cDNA ORF Clone, Rat, N-DDK (Flag®) tag

Cat: RG80490-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All TST Reagents
CRO Services
Product recommended

All TST Reagents
TST cDNA ORF Clone, Rat, N-DDK (Flag®) tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
894 bp
Description
Full length Clone DNA of Rat thiosulfate sulfurtransferase with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TST Background Information
Full Name
thiosulfate sulfurtransferase (rhodanese)

TST cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
TST cDNA ORF Clone in Cloning Vector, Rat RG80490-U
TST cDNA ORF Clone, Rat, untagged RG80490-UT
TST cDNA ORF Clone, Rat, C-GFPSpark® tag RG80490-ACG
TST Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80490-ACGLN
TST cDNA ORF Clone, Rat, N-GFPSpark® tag RG80490-ANG
TST cDNA ORF Clone, Rat, C-OFPSpark® tag RG80490-ACR
TST cDNA ORF Clone, Rat, N-OFPSpark® tag RG80490-ANR
TST cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80490-CF
TST cDNA ORF Clone, Rat, C-His tag RG80490-CH
TST cDNA ORF Clone, Rat, N-His tag RG80490-NH
TST cDNA ORF Clone, Rat, C-HA tag RG80490-CY
TST cDNA ORF Clone, Rat, N-HA tag RG80490-NY
TST cDNA ORF Clone, Rat, C-Myc tag RG80490-CM
TST cDNA ORF Clone, Rat, N-Myc tag RG80490-NM
TST qPCR Primer Pairs, Rat RP300454

TST cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TST cDNA ORF Clone in Cloning Vector, Mouse MG53519-G
TST cDNA ORF Clone, Mouse, untagged MG53519-UT
TST Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53519-ACGLN
TST cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53519-ACG
TST cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53519-ANG
TST cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53519-ACR
TST cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53519-ANR
TST cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53519-CF
TST cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53519-NF
TST cDNA ORF Clone, Mouse, C-His tag MG53519-CH
TST cDNA ORF Clone, Mouse, N-His tag MG53519-NH
TST cDNA ORF Clone, Mouse, C-HA tag MG53519-CY
TST cDNA ORF Clone, Mouse, N-HA tag MG53519-NY
TST cDNA ORF Clone, Mouse, C-Myc tag MG53519-CM
TST cDNA ORF Clone, Mouse, N-Myc tag MG53519-NM

TST cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TST cDNA ORF Clone, Human, untagged HG18634-UT
info info
添加购物车成功! 添加购物车失败!