Quick Order

Rat TALLA-1 / TSPAN7 (CD231) Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Rat TSPAN7 cDNA Clone Product Information
NCBI RefSeq:BC158792.1
RefSeq ORF Size:750bp
cDNA Description:Full length Clone DNA of Rattus norvegicus tetraspanin 7.
Gene Synonym:A15, MXS1, Tm4sf2, TALLA-1, DXS1692E, Tspan7
Species:Rat
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

TALLA-1, also known as TSPAN7, is a member of the transmembrane 4 superfamily Most members of this family are cell-surface proteins that are characterized by the presence of four hydrophobic domains. TALLA-1 gene is associated with X-linked mental retardation and neuropsychiatric diseases such as Huntington's chorea, fragile X syndrome and myotonic dystrophy. TALLA-1 is a cell surface glycoprotein and may have a role in the control of neurite outgrowth. It is known to complex with integrins.

References
  • Berditchevski F. 2002, J Cell Sci. 114 (23): 4143-51.
  • Castellví-Bel S. et al., 2001, Mol Genet Metab. 72 (2): 104-8.
  • Abidi FE. et al., 2002, J Med Genet. 39 (6): 430-3.
  • Size / Price
    Catalog: RG80372-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"