After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Rat TSPAN31 Gene ORF cDNA clone expression plasmid, C-His tag

DatasheetReviewsRelated ProductsProtocols
Rat TSPAN31 cDNA Clone Product Information
NCBI RefSeq:NM_001008378.1
RefSeq ORF Size:633bp
cDNA Description:Full length Clone DNA of Rattus norvegicus tetraspanin 31 with C terminal His tag.
Gene Synonym:Sas
Species:Rat
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

TSPAN31 is a member of the transmembrane 4 superfamily. Most members of this family are cell-surface proteins that are characterized by the presence of four hydrophobic domains. They mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. TSPAN31 is thought to be involved in growth-related cellular processes. This gene is associated with tumorigenesis and osteosarcoma.

References
  • Wright MD. et al., 1995, Immunol Today. 15 (12): 588-94.
  • Meltzer PS. et al., 1992, Cell Growth Differ. 2 (10): 495-501.
  • Jankowski SA. et al., 1995, Genomics. 25 (2): 501-6.
  • Size / Price
    Catalog: RG81110-CH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"