TSC22D3 cDNA ORF Clone, Rat, C-Myc tag

Cat: RG81293-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All TSC22D3 Reagents
CRO Services
Product recommended

All TSC22D3 Reagents
TSC22D3 cDNA ORF Clone, Rat, C-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
405 bp
Description
Full length Clone DNA of Rat TSC22 domain family, member 3 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TSC22D3 Background Information
Full Name
TSC22 domain family, member 3

TSC22D3 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
TSC22D3 cDNA ORF Clone in Cloning Vector, Rat RG81293-U
TSC22D3 cDNA ORF Clone, Rat, untagged RG81293-UT
TSC22D3 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81293-ACGLN
TSC22D3 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81293-ACG
TSC22D3 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81293-ANG
TSC22D3 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81293-ACR
TSC22D3 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81293-ANR
TSC22D3 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81293-CF
TSC22D3 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81293-NF
TSC22D3 cDNA ORF Clone, Rat, C-His tag RG81293-CH
TSC22D3 cDNA ORF Clone, Rat, N-His tag RG81293-NH
TSC22D3 cDNA ORF Clone, Rat, C-HA tag RG81293-CY
TSC22D3 cDNA ORF Clone, Rat, N-HA tag RG81293-NY
TSC22D3 cDNA ORF Clone, Rat, N-Myc tag RG81293-NM
TSC22D3 qPCR Primer Pairs, Rat RP301249

TSC22D3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TSC22D3 cDNA ORF Clone in Cloning Vector, Mouse MG52163-U
TSC22D3 cDNA ORF Clone, Mouse, untagged MG52163-UT
TSC22D3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52163-ACGLN
TSC22D3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52163-ACG
TSC22D3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52163-ANG
TSC22D3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52163-ACR
TSC22D3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52163-ANR
TSC22D3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52163-CF
TSC22D3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52163-NF
TSC22D3 cDNA ORF Clone, Mouse, C-His tag MG52163-CH
TSC22D3 cDNA ORF Clone, Mouse, N-His tag MG52163-NH
TSC22D3 cDNA ORF Clone, Mouse, C-HA tag MG52163-CY
TSC22D3 cDNA ORF Clone, Mouse, N-HA tag MG52163-NY
TSC22D3 cDNA ORF Clone, Mouse, C-Myc tag MG52163-CM
TSC22D3 cDNA ORF Clone, Mouse, N-Myc tag MG52163-NM
TSC22D3 qPCR Primer Pairs, Mouse MP202036

TSC22D3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TSC22D3 cDNA ORF Clone in Cloning Vector, Human HG29744-U
TSC22D3 cDNA ORF Clone in Cloning Vector, Human HG17067-U
TSC22D3 cDNA ORF Clone, Human, untagged HG17067-UT
TSC22D3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG17067-ACGLN
TSC22D3 cDNA ORF Clone, Human, C-GFPSpark® tag HG17067-ACG
TSC22D3 cDNA ORF Clone, Human, N-GFPSpark® tag HG17067-ANG
TSC22D3 cDNA ORF Clone, Human, C-OFPSpark® tag HG17067-ACR
TSC22D3 cDNA ORF Clone, Human, N-OFPSpark® tag HG17067-ANR
TSC22D3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG17067-CF
TSC22D3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG17067-NF
TSC22D3 cDNA ORF Clone, Human, C-His tag HG17067-CH
TSC22D3 cDNA ORF Clone, Human, N-His tag HG17067-NH
TSC22D3 cDNA ORF Clone, Human, C-HA tag HG17067-CY
TSC22D3 cDNA ORF Clone, Human, N-HA tag HG17067-NY
TSC22D3 cDNA ORF Clone, Human, C-Myc tag HG17067-CM
TSC22D3 cDNA ORF Clone, Human, N-Myc tag HG17067-NM
info info
添加购物车成功! 添加购物车失败!