TRIQK cDNA ORF Clone, Rat, N-Myc tag

Cat: RG80950-NM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All TRIQK Reagents
CRO Services
Product recommended

All TRIQK Reagents
TRIQK cDNA ORF Clone, Rat, N-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
261 bp
Description
Full length Clone DNA of Rat triple QxxK/R motif containing with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TRIQK Background Information
Full Name
triple QxxK/R motif containing

TRIQK cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
TRIQK cDNA ORF Clone in Cloning Vector, Rat RG80950-U
TRIQK cDNA ORF Clone, Rat, untagged RG80950-UT
TRIQK Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80950-ACGLN
TRIQK cDNA ORF Clone, Rat, C-GFPSpark® tag RG80950-ACG
TRIQK cDNA ORF Clone, Rat, N-GFPSpark® tag RG80950-ANG
TRIQK cDNA ORF Clone, Rat, C-OFPSpark® tag RG80950-ACR
TRIQK cDNA ORF Clone, Rat, N-OFPSpark® tag RG80950-ANR
TRIQK cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80950-CF
TRIQK cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80950-NF
TRIQK cDNA ORF Clone, Rat, C-His tag RG80950-CH
TRIQK cDNA ORF Clone, Rat, N-His tag RG80950-NH
TRIQK cDNA ORF Clone, Rat, C-HA tag RG80950-CY
TRIQK cDNA ORF Clone, Rat, N-HA tag RG80950-NY
TRIQK cDNA ORF Clone, Rat, C-Myc tag RG80950-CM
TRIQK qPCR Primer Pairs, Rat RP300914

TRIQK cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TRIQK cDNA ORF Clone in Cloning Vector, Mouse MG52720-U
TRIQK cDNA ORF Clone, Mouse, untagged MG52720-UT
TRIQK Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52720-ACGLN
TRIQK cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52720-ACG
TRIQK cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52720-ANG
TRIQK cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52720-ACR
TRIQK cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52720-ANR
TRIQK cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52720-CF
TRIQK cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52720-NF
TRIQK cDNA ORF Clone, Mouse, C-His tag MG52720-CH
TRIQK cDNA ORF Clone, Mouse, N-His tag MG52720-NH
TRIQK cDNA ORF Clone, Mouse, C-HA tag MG52720-CY
TRIQK cDNA ORF Clone, Mouse, N-HA tag MG52720-NY
TRIQK cDNA ORF Clone, Mouse, C-Myc tag MG52720-CM
TRIQK cDNA ORF Clone, Mouse, N-Myc tag MG52720-NM
TRIQK qPCR Primer Pairs, Mouse MP202591
info info
添加购物车成功! 添加购物车失败!