TNNI1 cDNA ORF Clone, Rat, N-His tag

Cat: RG80529-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All TNNI1 Reagents
CRO Services
Product recommended

All TNNI1 Reagents
TNNI1 cDNA ORF Clone, Rat, N-His tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
564 bp
Description
Full length Clone DNA of Rat troponin I type 1 (skeletal, slow) with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TNNI1 Background Information
Full Name
troponin I type 1 (skeletal, slow)

TNNI1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
TNNI1 cDNA ORF Clone in Cloning Vector, Rat RG80529-U
TNNI1 cDNA ORF Clone, Rat, untagged RG80529-UT
TNNI1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80529-ACG
TNNI1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80529-ACGLN
TNNI1 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80529-ANG
TNNI1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80529-ACR
TNNI1 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80529-ANR
TNNI1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80529-CF
TNNI1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80529-NF
TNNI1 cDNA ORF Clone, Rat, C-His tag RG80529-CH
TNNI1 cDNA ORF Clone, Rat, C-HA tag RG80529-CY
TNNI1 cDNA ORF Clone, Rat, N-HA tag RG80529-NY
TNNI1 cDNA ORF Clone, Rat, C-Myc tag RG80529-CM
TNNI1 cDNA ORF Clone, Rat, N-Myc tag RG80529-NM
TNNI1 qPCR Primer Pairs, Rat RP300493

TNNI1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TNNI1 cDNA ORF Clone in Cloning Vector, Mouse MG53930-U
TNNI1 cDNA ORF Clone, Mouse, untagged MG53930-UT
TNNI1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53930-ACGLN
TNNI1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53930-ACG
TNNI1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53930-ANG
TNNI1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53930-ACR
TNNI1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53930-ANR
TNNI1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53930-CF
TNNI1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53930-NF
TNNI1 cDNA ORF Clone, Mouse, C-His tag MG53930-CH
TNNI1 cDNA ORF Clone, Mouse, N-His tag MG53930-NH
TNNI1 cDNA ORF Clone, Mouse, C-HA tag MG53930-CY
TNNI1 cDNA ORF Clone, Mouse, N-HA tag MG53930-NY
TNNI1 cDNA ORF Clone, Mouse, C-Myc tag MG53930-CM
TNNI1 cDNA ORF Clone, Mouse, N-Myc tag MG53930-NM

TNNI1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TNNI1 cDNA ORF Clone in Cloning Vector, Human HG19386-U
info info
添加购物车成功! 添加购物车失败!