Text Size:AAA

Rat OX-40L / TNFSF4 / CD252 Gene ORF cDNA clone expression plasmid, N-Flag tag

    DatasheetReviewsRelated ProductsProtocols
    Rat TNFSF4 cDNA Clone Product Information
    NCBI RefSeq:NM_053552.1
    RefSeq ORF Size:600bp
    cDNA Description:Full length Clone DNA of Rattus norvegicus tumor necrosis factor (ligand) superfamily, member 4 with N terminal Flag tag.
    Gene Synonym:Ox40l, Txgp1, Tnfsf4
    Species:Rat
    Vector:pCMV3-SP-N-FLAG
    Plasmid:
    Restriction Site:
    Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with TNFSF4 qPCR primers for gene expression analysis, RP300141 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    FLAG Tag Info

    FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

    The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

    Product nameProduct name
    Background

    OX-40L, also known as TNFSF4 and CD252, is a cytokine that belongs to the tumor necrosis factor (TNF) ligand family. OX-40L is an important costimulatory molecule that plays a crucial role in the regulation of T-cell-mediated immunity. The interaction of TNFSF4-TNFSF4 is involved in the pathogenesis of multiple autoimmune and inflammatory diseases such as systemic lupus erythematosus (SLE), carotid artery disease and cancer. OX-40L is a ligand for receptor TNFRSF4/OX4. It is found to play a role in T cell antigen-presenting cell (APC) interactions. In surface Ig- and CD40-stimulated B cells, this cytokine along with CD70 has been shown to provide CD28-independent costimulatory signals to T cells. This protein and its receptor are reported to directly mediate adhesion of activated T cells to vascular endothelial cells.

    Immune Checkpoint
    Immune Checkpoint Targets   Co-stimulatory Immune Checkpoint Targets

    Immunotherapy   Cancer Immunotherapy   Targeted Therapy

    References
  • Lei W. et al., 2012, Ann Acad Med Singapore. 41 (5): 200-4.
  • Lee YH. et al., 2012, Hum Immunol. 73 (10): 1050-4.
  • Weiguang Y. et al., 2012, PLoS One. 7 (8): e41277.
  • Size / Price
    Catalog: RG80146-NF
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"