Text Size:AAA

Rat TNFSF12 Gene ORF cDNA clone expression plasmid, N-HA tag

    DatasheetReviewsRelated ProductsProtocols
    Rat TNFSF12 cDNA Clone Product Information
    NCBI RefSeq:NM_001001513.2
    RefSeq ORF Size:750bp
    cDNA Description:Full length Clone DNA of Rattus norvegicus tumor necrosis factor ligand superfamily member 12 with N terminal HA tag.
    Gene Synonym:TWEAK, Prmt2, Tnfsf12
    Species:Rat
    Vector:pCMV3-SP-N-HA
    Plasmid:
    Restriction Site:
    Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with TNFSF12 qPCR primers for gene expression analysis, RP300149 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Product nameProduct name
    Background

    TNFSF12 is a cytokine that belongs to the tumor necrosis factor (TNF) ligand family. It is a ligand for the FN14/TWEAKR receptor. TNFSF12 has overlapping signaling functions with TNF, but displays a much wider tissue distribution. It can induce apoptosis via multiple pathways of cell death in a cell type-specific manner. It is also found that TNFSF12 promotes proliferation and migration of endothelial cells, and thus acts as a regulator of angiogenesis. TNFSF12 also is a weak inducer of apoptosis in some cell types and mediates NF-kappa-B activation.

    Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

    References
  • Wiley SR, et al. (2004) TWEAK, a member of the TNF superfamily, is a multifunctional cytokine that binds the TweakR/Fn14 receptor. Cytokine Growth Factor Rev. 14(3-4):241-9.
  • Campbell S, et al. (2006) The role of TWEAK/Fn14 in the pathogenesis of inflammation and systemic autoimmunity. Front Biosci. 9:2273-84.
  • Lynch CN, et al. (1999) TWEAK induces angiogenesis and proliferation of endothelial cells. J Biol Chem. 274(13):8455-9.
  • Size / Price
    Catalog: RG80154-NY
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"