RANKL cDNA ORF Clone, Rat, C-Myc tag

Cat: RG80165-CM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All RANKL Reagents
CRO Services
Product recommended

All RANKL Reagents
RANKL cDNA ORF Clone, Rat, C-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
957 bp
Description
Full length Clone DNA of Rat tumor necrosis factor (ligand) superfamily, member 11 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RANKL Background Information

Tumor necrosis factor ligand superfamily member 11, also known as Receptor activator of nuclear factor kappa-B ligand, Osteoprotegerin ligand, TNFSF11, RANKL, TRANCE, OPGL and CD254, is a single-pass type II membrane protein which belongs to the tumor necrosis factor family. The receptor activator of nuclear factor-kappaB ligand (RANKL), its cognate receptor RANK, and its natural decoy receptor osteoprotegerin have been identified as the final effector molecules of osteoclastic bone resorption. RANK and RANKL are key regulators of bone remodeling and regulate T cell/dendritic cell communications, and lymph node formation. Moreover, RANKL and RANK are expressed in mammary gland epithelial cells and control the development of a lactating mammary gland during pregnancy. Genetically, RANKL and RANK are essential for the development and activation of osteoclasts and bone loss in response to virtually all triggers tested. Inhibition of RANKL function via the natural decoy receptor osteoprotegerin (OPG, TNFRSF11B) prevents bone loss in postmenopausal osteoporosis and cancer metastases. Importantly, RANKL appears to be the pathogenetic principle that causes bone and cartilage destruction in arthritis. RANK-RANKL signaling not only activates a variety of downstream signaling pathways required for osteoclast development, but crosstalk with other signaling pathways also fine-tunes bone homeostasis both in normal physiology and disease. In addition, RANKL and RANK have essential roles in lymph node formation, establishment of the thymic microenvironment, and development of a lactating mammary gland during pregnancy.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
tumor necrosis factor (ligand) superfamily, member 11
References
  • Takayanagi H, et al. (2002) Signaling crosstalk between RANKL and interferons in osteoclast differentiation. Arthritis Res. 4 Suppl 3: S227-32.
  • Nakashima T, et al. (2003) RANKL and RANK as novel therapeutic targets for arthritis. Curr Opin Rheumatol. 15(3): 280-7.
  • Schwarz EM, et al. (2007) Clinical development of anti-RANKL therapy. Arthritis Res Ther. 9 Suppl 1: S7.
  • Leibbrandt A, et al. (2008) RANK/RANKL: regulators of immune responses and bone physiology. Ann N Y Acad Sci. 1143: 123-50.
  • RANKL cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    RANKL cDNA ORF Clone in Cloning Vector, Rhesus CG90301-G
    RANKL cDNA ORF Clone, Rhesus, untagged CG90301-UT
    RANKL cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90301-ACG
    RANKL Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90301-ACGLN
    RANKL cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90301-ACR
    RANKL cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90301-CF
    RANKL cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90301-NF
    RANKL cDNA ORF Clone, Rhesus, C-His tag CG90301-CH
    RANKL cDNA ORF Clone, Rhesus, N-His tag CG90301-NH
    RANKL cDNA ORF Clone, Rhesus, C-HA tag CG90301-CY
    RANKL cDNA ORF Clone, Rhesus, N-HA tag CG90301-NY
    RANKL cDNA ORF Clone, Rhesus, C-Myc tag CG90301-CM
    RANKL cDNA ORF Clone, Rhesus, N-Myc tag CG90301-NM

    RANKL cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    RANKL cDNA ORF Clone in Cloning Vector, Rat RG80165-G
    RANKL cDNA ORF Clone, Rat, untagged RG80165-UT
    RANKL cDNA ORF Clone, Rat, C-GFPSpark® tag RG80165-ACG
    RANKL Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80165-ACGLN
    RANKL cDNA ORF Clone, Rat, C-OFPSpark® tag RG80165-ACR
    RANKL cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80165-CF
    RANKL cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80165-NF
    RANKL cDNA ORF Clone, Rat, C-His tag RG80165-CH
    RANKL cDNA ORF Clone, Rat, N-His tag RG80165-NH
    RANKL cDNA ORF Clone, Rat, C-HA tag RG80165-CY
    RANKL cDNA ORF Clone, Rat, N-HA tag RG80165-NY
    RANKL cDNA ORF Clone, Rat, N-Myc tag RG80165-NM
    RANKL qPCR Primer Pairs, Rat RP300159

    RANKL cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    RANKL cDNA ORF Clone in Cloning Vector, Mouse MG50343-M
    RANKL cDNA ORF Clone, Mouse, untagged MG50343-UT
    RANKL Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50343-ACGLN
    RANKL cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50343-ACG
    RANKL cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50343-ACR
    RANKL cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50343-CF
    RANKL cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50343-NF
    RANKL cDNA ORF Clone, Mouse, C-His tag MG50343-CH
    RANKL cDNA ORF Clone, Mouse, N-His tag MG50343-NH
    RANKL cDNA ORF Clone, Mouse, C-HA tag MG50343-CY
    RANKL cDNA ORF Clone, Mouse, N-HA tag MG50343-NY
    RANKL cDNA ORF Clone, Mouse, C-Myc tag MG50343-CM
    RANKL cDNA ORF Clone, Mouse, N-Myc tag MG50343-NM
    RANKL qPCR Primer Pairs, Mouse MP200365

    RANKL cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    RANKL cDNA ORF Clone in Cloning Vector, Human HG11682-G
    RANKL cDNA ORF Clone, Human, untagged HG11682-UT
    RANKL Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11682-ACGLN
    RANKL cDNA ORF Clone, Human, C-GFPSpark® tag HG11682-ACG
    RANKL cDNA ORF Clone, Human, C-OFPSpark® tag HG11682-ACR
    RANKL cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11682-CF
    RANKL cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11682-NF
    RANKL cDNA ORF Clone, Human, C-His tag HG11682-CH
    RANKL cDNA ORF Clone, Human, N-His tag HG11682-NH
    RANKL cDNA ORF Clone, Human, C-HA tag HG11682-CY
    RANKL cDNA ORF Clone, Human, N-HA tag HG11682-NY
    RANKL cDNA ORF Clone, Human, C-Myc tag HG11682-CM
    RANKL cDNA ORF Clone, Human, N-Myc tag HG11682-NM
    RANKL qPCR Primer Pairs, Human HP101516
    info info
    添加购物车成功! 添加购物车失败!