GITR cDNA ORF Clone, Rat, C-Myc tag

Cat: RG80192-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All GITR Reagents
CRO Services
Product recommended

All GITR Reagents
GITR cDNA ORF Clone, Rat, C-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
366 bp
Description
Full length Clone DNA of Rat tumor necrosis factor receptor superfamily, member 18 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GITR Background Information

GITR, also known as TNFRSF18(CD357), belongs to the tumor necrosis factor receptor (TNF-R) superfamily. It is the receptor for TNFSF18. GITR plays a key role in dominant immunological self-tolerance maintained by CD25(+)CD4(+) regulatory T cells. GITR may be involved in interactions between activated T-lymphocytes and endothelial cells and in the regulation of T-cell receptor-mediated cell death. GITR and its ligand are important costimulatory molecules in the pathogenesis of autoimmune diseases. It also mediates NF-kappa-B activation via the TRAF2/NIK pathway.

Immune Checkpoint
Immune Checkpoint Detection: ELISA Antibodies
Immune Checkpoint Targets   Co-stimulatory Immune Checkpoint Targets

Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
tumor necrosis factor receptor superfamily, member 18
References
  • Kwon B, et al. (1999) Identification of a novel activation-inducible protein of the tumor necrosis factor receptor superfamily and its ligand. J Biol Chem. 274(10):6056-61.
  • Nocentini G, et al. (1997) A new member of the tumor necrosis factor/nerve growth factor receptor family inhibits T cell receptor-induced apoptosis. Proc Natl Acad Sci. 94(12): 6216-21.
  • Baltz KM, et al. (2007) Cancer immunoediting by GITR (glucocorticoid-induced TNF-related protein) ligand in humans: NK cell/tumor cell interactions. FASEB J. 21(10):2442-54.
  • GITR cDNA ORF Clone, Cynomolgus, Related Products

    Product Name Catalog#(PDF)
    GITR cDNA ORF Clone in Cloning Vector, Cynomolgus CG90871-G

    GITR cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    GITR cDNA ORF Clone in Cloning Vector, Rat RG80192-G
    GITR cDNA ORF Clone, Rat, untagged RG80192-UT
    GITR cDNA ORF Clone, Rat, C-GFPSpark® tag RG80192-ACG
    GITR Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80192-ACGLN
    GITR cDNA ORF Clone, Rat, C-OFPSpark® tag RG80192-ACR
    GITR cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80192-CF
    GITR cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80192-NF
    GITR cDNA ORF Clone, Rat, C-His tag RG80192-CH
    GITR cDNA ORF Clone, Rat, N-His tag RG80192-NH
    GITR cDNA ORF Clone, Rat, C-HA tag RG80192-CY
    GITR cDNA ORF Clone, Rat, N-HA tag RG80192-NY
    GITR cDNA ORF Clone, Rat, N-Myc tag RG80192-NM
    GITR qPCR Primer Pairs, Rat RP300184

    GITR cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    GITR cDNA ORF Clone in Cloning Vector, Mouse MG57511-G
    GITR Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG57511-ACGLN

    GITR cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    GITR cDNA ORF Clone in Cloning Vector, Human HG13643-G
    GITR cDNA ORF Clone, Human, untagged HG13643-UT
    GITR Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13643-ACGLN
    GITR cDNA ORF Clone, Human, C-GFPSpark® tag HG13643-ACG
    GITR cDNA ORF Clone, Human, C-OFPSpark® tag HG13643-ACR
    GITR cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13643-CF
    GITR cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13643-NF
    GITR cDNA ORF Clone, Human, C-His tag HG13643-CH
    GITR cDNA ORF Clone, Human, N-His tag HG13643-NH
    GITR cDNA ORF Clone, Human, C-HA tag HG13643-CY
    GITR cDNA ORF Clone, Human, N-HA tag HG13643-NY
    GITR cDNA ORF Clone, Human, C-Myc tag HG13643-CM
    GITR cDNA ORF Clone, Human, N-Myc tag HG13643-NM
    GITR qPCR Primer Pairs, Human HP102326
    info info
    添加购物车成功! 添加购物车失败!