HVEM cDNA ORF Clone, Rat, C-HA tag

Cat: RG80449-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All HVEM Reagents
CRO Services
Product recommended

All HVEM Reagents
HVEM cDNA ORF Clone, Rat, C-HA tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
837 bp
Description
Full length Clone DNA of Rat tumor necrosis factor receptor superfamily, member 14 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

HVEM Background Information

Herpesvirus entry mediator (HVEM), also referred to as TNFRSF14, TR2 (TNF receptor-like molecule) and ATAR (another TRAF-associated receptor), is a member of type I transmembrane protein belonging to the TNF-receptor superfamily. It is expressed on many immune cells, including T and B cells, NK cells, monocytes, and neutrophils. Two TNF superfamily ligands lymphotoxin α (TNF-β) and LIGHT (TNFSF14) are identified as cellular ligands for HVEM and initiate the positive signaling. However, recent studies have revealed that HVEM is also involved in the unique inhibitory signaling pathway for T cells through activating tyrosine phosphorylation of the immunoreceptor tyrosine-based inhibitory motif (ITIM) in B and T lymphocyte attenuator (BTLA). HVEM provides a stimulatory signal following engagement with LIGHT (TNFSF14) on T cells. In contrast, it can also provide an inhibitory signal to T cells when it binds the B and T lymphocyte attenuator (BTLA), a ligand member of the Immunoglobulin (Ig) superfamily. Thus, HVEM may be viewed as a molecular switch, capable of facilitating both stimulatory and inhibitory cosignaling in T cells. Substantial evidence from both human disease and from experimental mouse models has indicated that dysregulation of the LIGHT-HVEM-BTLA cosignaling pathway can cause inflammation in the lung and in mucosal tissues.

Immune Checkpoint
Immune Checkpoint Detection: Antibodies   Immune Checkpoint Detection: ELISA Antibodies
Immune Checkpoint Proteins
Immune Checkpoint Targets   Co-inhibitory Immune Checkpoint Targets

Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
tumor necrosis factor receptor superfamily, member 14
References
  • Murphy KM, et al. (2006) Balancing co-stimulation and inhibition with BTLA and HVEM. Nat Rev Immunol. 6(9): 671-81.
  • Heo SK, et al. (2007) HVEM signaling in monocytes is mediated by intracellular calcium mobilization. J Immunol. 179(9): 6305-10.
  • Steinberg MW, et al. (2008) A crucial role for HVEM and BTLA in preventing intestinal inflammation. J Exp Med. 205(6): 1463-76.
  • Pasero C, et al. (2009) A role for HVEM, but not lymphotoxin-beta receptor, in LIGHT-induced tumor cell death and chemokine production. Eur J Immunol. 39(9): 2502-14.
  • Cheung TC. Modulation of T cell proliferation through the LIGHT-HVEM-BTLA cosignaling pathway. Recent Pat DNA Gene Seq. 3(3): 177-82.
  • HVEM cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    HVEM cDNA ORF Clone in Cloning Vector, Rhesus CG90109-G
    HVEM cDNA ORF Clone, Rhesus, untagged CG90109-UT
    HVEM cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90109-ACG
    HVEM Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90109-ACGLN
    HVEM cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90109-ACR
    HVEM cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90109-CF
    HVEM cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90109-NF
    HVEM cDNA ORF Clone, Rhesus, C-His tag CG90109-CH
    HVEM cDNA ORF Clone, Rhesus, N-His tag CG90109-NH
    HVEM cDNA ORF Clone, Rhesus, C-HA tag CG90109-CY
    HVEM cDNA ORF Clone, Rhesus, N-HA tag CG90109-NY
    HVEM cDNA ORF Clone, Rhesus, C-Myc tag CG90109-CM
    HVEM cDNA ORF Clone, Rhesus, N-Myc tag CG90109-NM

    HVEM cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    HVEM cDNA ORF Clone in Cloning Vector, Rat RG80449-G
    HVEM cDNA ORF Clone, Rat, untagged RG80449-UT
    HVEM cDNA ORF Clone, Rat, C-GFPSpark® tag RG80449-ACG
    HVEM Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80449-ACGLN
    HVEM cDNA ORF Clone, Rat, C-OFPSpark® tag RG80449-ACR
    HVEM cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80449-CF
    HVEM cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80449-NF
    HVEM cDNA ORF Clone, Rat, C-His tag RG80449-CH
    HVEM cDNA ORF Clone, Rat, N-His tag RG80449-NH
    HVEM cDNA ORF Clone, Rat, N-HA tag RG80449-NY
    HVEM cDNA ORF Clone, Rat, C-Myc tag RG80449-CM
    HVEM cDNA ORF Clone, Rat, N-Myc tag RG80449-NM
    HVEM qPCR Primer Pairs, Rat RP300416

    HVEM cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    HVEM cDNA ORF Clone, Mouse, untagged MG50550-UT
    HVEM Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50550-ACGLN
    HVEM cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50550-ACG
    HVEM cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50550-ACR
    HVEM cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50550-CF
    HVEM cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50550-NF
    HVEM cDNA ORF Clone, Mouse, N-His tag MG50550-NH
    HVEM cDNA ORF Clone, Mouse, C-HA tag MG50550-CY
    HVEM cDNA ORF Clone, Mouse, N-HA tag MG50550-NY
    HVEM cDNA ORF Clone, Mouse, C-Myc tag MG50550-CM
    HVEM qPCR Primer Pairs, Mouse MP200542

    HVEM cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    HVEM cDNA ORF Clone in Cloning Vector, Human HG10334-G
    HVEM cDNA ORF Clone, Human, untagged HG10334-UT
    HVEM Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10334-ACGLN
    HVEM cDNA ORF Clone, Human, C-GFPSpark® tag HG10334-ACG
    HVEM cDNA ORF Clone, Human, C-OFPSpark® tag HG10334-ACR
    HVEM cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10334-CF
    HVEM cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10334-NF
    HVEM cDNA ORF Clone, Human, C-His tag HG10334-CH
    HVEM cDNA ORF Clone, Human, N-His tag HG10334-NH
    HVEM cDNA ORF Clone, Human, C-HA tag HG10334-CY
    HVEM cDNA ORF Clone, Human, N-HA tag HG10334-NY
    HVEM cDNA ORF Clone, Human, C-Myc tag HG10334-CM
    HVEM cDNA ORF Clone, Human, N-Myc tag HG10334-NM
    HVEM qPCR Primer Pairs, Human HP100374
    info info
    添加购物车成功! 添加购物车失败!