TNFAIP6 cDNA ORF Clone, Rat, C-HA tag

Cat: RG80626-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All TNFAIP6 Reagents
CRO Services
Product recommended

All TNFAIP6 Reagents
TNFAIP6 cDNA ORF Clone, Rat, C-HA tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
828 bp
Description
Full length Clone DNA of Rat tumor necrosis factor alpha induced protein 6 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TNFAIP6 Background Information
Full Name
tumor necrosis factor, alpha-induced protein 6

TNFAIP6 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
TNFAIP6 cDNA ORF Clone in Cloning Vector, Rat RG80626-U
TNFAIP6 cDNA ORF Clone, Rat, untagged RG80626-UT
TNFAIP6 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80626-ACG
TNFAIP6 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80626-ACGLN
TNFAIP6 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80626-ACR
TNFAIP6 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80626-CF
TNFAIP6 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80626-NF
TNFAIP6 cDNA ORF Clone, Rat, C-His tag RG80626-CH
TNFAIP6 cDNA ORF Clone, Rat, N-His tag RG80626-NH
TNFAIP6 cDNA ORF Clone, Rat, N-HA tag RG80626-NY
TNFAIP6 cDNA ORF Clone, Rat, C-Myc tag RG80626-CM
TNFAIP6 cDNA ORF Clone, Rat, N-Myc tag RG80626-NM
TNFAIP6 qPCR Primer Pairs, Rat RP300590

TNFAIP6 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TNFAIP6 cDNA ORF Clone in Cloning Vector, Mouse MG50498-M
TNFAIP6 cDNA ORF Clone, Mouse, untagged MG50498-UT
TNFAIP6 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50498-ACGLN
TNFAIP6 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50498-ACG
TNFAIP6 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50498-ANG
TNFAIP6 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50498-ACR
TNFAIP6 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50498-ANR
TNFAIP6 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50498-CF
TNFAIP6 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50498-NF
TNFAIP6 cDNA ORF Clone, Mouse, C-His tag MG50498-CH
TNFAIP6 cDNA ORF Clone, Mouse, N-His tag MG50498-NH
TNFAIP6 cDNA ORF Clone, Mouse, C-HA tag MG50498-CY
TNFAIP6 cDNA ORF Clone, Mouse, N-HA tag MG50498-NY
TNFAIP6 cDNA ORF Clone, Mouse, C-Myc tag MG50498-CM
TNFAIP6 cDNA ORF Clone, Mouse, N-Myc tag MG50498-NM
TNFAIP6 qPCR Primer Pairs, Mouse MP200492

TNFAIP6 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TNFAIP6 cDNA ORF Clone in Cloning Vector, Human HG10931-M
TNFAIP6 cDNA ORF Clone, Human, untagged HG10931-UT
TNFAIP6 cDNA ORF Clone, Human, C-GFPSpark® tag HG10931-ACG
TNFAIP6 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10931-ACGLN
TNFAIP6 cDNA ORF Clone, Human, C-OFPSpark® tag HG10931-ACR
TNFAIP6 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10931-CF
TNFAIP6 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10931-NF
TNFAIP6 cDNA ORF Clone, Human, C-His tag HG10931-CH
TNFAIP6 cDNA ORF Clone, Human, N-His tag HG10931-NH
TNFAIP6 cDNA ORF Clone, Human, C-HA tag HG10931-CY
TNFAIP6 cDNA ORF Clone, Human, N-HA tag HG10931-NY
TNFAIP6 cDNA ORF Clone, Human, C-Myc tag HG10931-CM
TNFAIP6 cDNA ORF Clone, Human, N-Myc tag HG10931-NM
TNFAIP6 qPCR Primer Pairs, Human HP100812
info info
添加购物车成功! 添加购物车失败!