TMSB4X cDNA ORF Clone, Rat, N-His tag

Cat: RG80497-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All TMSB4X Reagents
CRO Services
Product recommended

All TMSB4X Reagents
TMSB4X cDNA ORF Clone, Rat, N-His tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
135 bp
Description
Full length Clone DNA of Rat thymosin beta 4, X-linked with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TMSB4X Background Information
Full Name
thymosin beta 4, X-linked

TMSB4X cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
TMSB4X cDNA ORF Clone in Cloning Vector, Rat RG80497-U
TMSB4X cDNA ORF Clone, Rat, untagged RG80497-UT
TMSB4X cDNA ORF Clone, Rat, C-GFPSpark® tag RG80497-ACG
TMSB4X Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80497-ACGLN
TMSB4X cDNA ORF Clone, Rat, N-GFPSpark® tag RG80497-ANG
TMSB4X cDNA ORF Clone, Rat, C-OFPSpark® tag RG80497-ACR
TMSB4X cDNA ORF Clone, Rat, N-OFPSpark® tag RG80497-ANR
TMSB4X cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80497-CF
TMSB4X cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80497-NF
TMSB4X cDNA ORF Clone, Rat, C-His tag RG80497-CH
TMSB4X cDNA ORF Clone, Rat, C-HA tag RG80497-CY
TMSB4X cDNA ORF Clone, Rat, N-HA tag RG80497-NY
TMSB4X cDNA ORF Clone, Rat, C-Myc tag RG80497-CM
TMSB4X cDNA ORF Clone, Rat, N-Myc tag RG80497-NM
TMSB4X qPCR Primer Pairs, Rat RP300461

TMSB4X cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TMSB4X cDNA ORF Clone in Cloning Vector, Mouse MG51228-U
TMSB4X cDNA ORF Clone, Mouse, untagged MG51228-UT
TMSB4X cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51228-ACG
TMSB4X Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51228-ACGLN
TMSB4X cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51228-ANG
TMSB4X cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51228-ACR
TMSB4X cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51228-ANR
TMSB4X cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51228-CF
TMSB4X cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51228-NF
TMSB4X cDNA ORF Clone, Mouse, C-His tag MG51228-CH
TMSB4X cDNA ORF Clone, Mouse, N-His tag MG51228-NH
TMSB4X cDNA ORF Clone, Mouse, C-HA tag MG51228-CY
TMSB4X cDNA ORF Clone, Mouse, N-HA tag MG51228-NY
TMSB4X cDNA ORF Clone, Mouse, C-Myc tag MG51228-CM
TMSB4X cDNA ORF Clone, Mouse, N-Myc tag MG51228-NM
TMSB4X qPCR Primer Pairs, Mouse MP201111

TMSB4X cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TMSB4X cDNA ORF Clone in Cloning Vector, Human HG15995-G
TMSB4X cDNA ORF Clone, Human, untagged HG15995-UT
TMSB4X cDNA ORF Clone, Human, C-GFPSpark® tag HG15995-ACG
TMSB4X Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15995-ACGLN
TMSB4X cDNA ORF Clone, Human, N-GFPSpark® tag HG15995-ANG
TMSB4X cDNA ORF Clone, Human, C-OFPSpark® tag HG15995-ACR
TMSB4X cDNA ORF Clone, Human, N-OFPSpark® tag HG15995-ANR
TMSB4X cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15995-CF
TMSB4X cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15995-NF
TMSB4X cDNA ORF Clone, Human, C-His tag HG15995-CH
TMSB4X cDNA ORF Clone, Human, N-His tag HG15995-NH
TMSB4X cDNA ORF Clone, Human, C-HA tag HG15995-CY
TMSB4X cDNA ORF Clone, Human, N-HA tag HG15995-NY
TMSB4X cDNA ORF Clone, Human, C-Myc tag HG15995-CM
TMSB4X cDNA ORF Clone, Human, N-Myc tag HG15995-NM
TMSB4X qPCR Primer Pairs, Human HP104582
info info
添加购物车成功! 添加购物车失败!