TMEM97 cDNA ORF Clone, Rat, C-Myc tag

Cat: RG81128-CM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All TMEM97 Reagents
CRO Services
Product recommended

All TMEM97 Reagents
TMEM97 cDNA ORF Clone, Rat, C-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
531 bp
Description
Full length Clone DNA of Rat transmembrane protein 97 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TMEM97 Background Information
Full Name
transmembrane protein 97

TMEM97 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
TMEM97 cDNA ORF Clone in Cloning Vector, Rat RG81128-U
TMEM97 cDNA ORF Clone, Rat, untagged RG81128-UT
TMEM97 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81128-ACG
TMEM97 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81128-ACGLN
TMEM97 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81128-ANG
TMEM97 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81128-ACR
TMEM97 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81128-ANR
TMEM97 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81128-CF
TMEM97 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81128-NF
TMEM97 cDNA ORF Clone, Rat, C-His tag RG81128-CH
TMEM97 cDNA ORF Clone, Rat, N-His tag RG81128-NH
TMEM97 cDNA ORF Clone, Rat, C-HA tag RG81128-CY
TMEM97 cDNA ORF Clone, Rat, N-HA tag RG81128-NY
TMEM97 cDNA ORF Clone, Rat, N-Myc tag RG81128-NM
TMEM97 qPCR Primer Pairs, Rat RP301085

TMEM97 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TMEM97 cDNA ORF Clone in Cloning Vector, Mouse MG53817-U
TMEM97 cDNA ORF Clone, Mouse, untagged MG53817-UT
TMEM97 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53817-ACGLN
TMEM97 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53817-ACG
TMEM97 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53817-ANG
TMEM97 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53817-ACR
TMEM97 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53817-ANR
TMEM97 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53817-CF
TMEM97 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53817-NF
TMEM97 cDNA ORF Clone, Mouse, C-His tag MG53817-CH
TMEM97 cDNA ORF Clone, Mouse, N-His tag MG53817-NH
TMEM97 cDNA ORF Clone, Mouse, C-HA tag MG53817-CY
TMEM97 cDNA ORF Clone, Mouse, N-HA tag MG53817-NY
TMEM97 cDNA ORF Clone, Mouse, C-Myc tag MG53817-CM
TMEM97 cDNA ORF Clone, Mouse, N-Myc tag MG53817-NM

TMEM97 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TMEM97 cDNA ORF Clone in Cloning Vector, Human HG11353-M
TMEM97 cDNA ORF Clone, Human, untagged HG11353-UT
TMEM97 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11353-ACGLN
TMEM97 cDNA ORF Clone, Human, C-GFPSpark® tag HG11353-ACG
TMEM97 cDNA ORF Clone, Human, N-GFPSpark® tag HG11353-ANG
TMEM97 cDNA ORF Clone, Human, C-OFPSpark® tag HG11353-ACR
TMEM97 cDNA ORF Clone, Human, N-OFPSpark® tag HG11353-ANR
TMEM97 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11353-CF
TMEM97 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11353-NF
TMEM97 cDNA ORF Clone, Human, C-His tag HG11353-CH
TMEM97 cDNA ORF Clone, Human, N-His tag HG11353-NH
TMEM97 cDNA ORF Clone, Human, C-HA tag HG11353-CY
TMEM97 cDNA ORF Clone, Human, N-HA tag HG11353-NY
TMEM97 cDNA ORF Clone, Human, C-Myc tag HG11353-CM
TMEM97 cDNA ORF Clone, Human, N-Myc tag HG11353-NM
TMEM97 qPCR Primer Pairs, Human HP101238
info info
添加购物车成功! 添加购物车失败!