TMEM60 cDNA ORF Clone, Rat, C-DDK (Flag®) tag

Cat: RG81166-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All TMEM60 Reagents
CRO Services
Product recommended

All TMEM60 Reagents
TMEM60 cDNA ORF Clone, Rat, C-DDK (Flag®) tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
402 bp
Description
Full length Clone DNA of Rat transmembrane protein 60 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TMEM60 Background Information
Full Name
transmembrane protein 60

TMEM60 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
TMEM60 cDNA ORF Clone in Cloning Vector, Rat RG81166-U
TMEM60 cDNA ORF Clone, Rat, untagged RG81166-UT
TMEM60 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81166-ACG
TMEM60 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81166-ACGLN
TMEM60 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81166-ACR
TMEM60 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81166-NF
TMEM60 cDNA ORF Clone, Rat, C-His tag RG81166-CH
TMEM60 cDNA ORF Clone, Rat, N-His tag RG81166-NH
TMEM60 cDNA ORF Clone, Rat, C-HA tag RG81166-CY
TMEM60 cDNA ORF Clone, Rat, N-HA tag RG81166-NY
TMEM60 cDNA ORF Clone, Rat, C-Myc tag RG81166-CM
TMEM60 cDNA ORF Clone, Rat, N-Myc tag RG81166-NM
TMEM60 qPCR Primer Pairs, Rat RP301122

TMEM60 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TMEM60 cDNA ORF Clone in Cloning Vector, Mouse MG5A4058-U
TMEM60 cDNA ORF Clone, Mouse, untagged MG5A4058-UT
TMEM60 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A4058-ACGLN
TMEM60 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A4058-ACG
TMEM60 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A4058-ACR
TMEM60 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A4058-CF
TMEM60 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A4058-NF
TMEM60 cDNA ORF Clone, Mouse, C-His tag MG5A4058-CH
TMEM60 cDNA ORF Clone, Mouse, N-His tag MG5A4058-NH
TMEM60 cDNA ORF Clone, Mouse, C-HA tag MG5A4058-CY
TMEM60 cDNA ORF Clone, Mouse, N-HA tag MG5A4058-NY
TMEM60 cDNA ORF Clone, Mouse, C-Myc tag MG5A4058-CM
TMEM60 cDNA ORF Clone, Mouse, N-Myc tag MG5A4058-NM

TMEM60 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TMEM60 cDNA ORF Clone in Cloning Vector, Human HG16961-U
TMEM60 cDNA ORF Clone, Human, untagged HG16961-UT
TMEM60 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16961-ACGLN
TMEM60 cDNA ORF Clone, Human, C-GFPSpark® tag HG16961-ACG
TMEM60 cDNA ORF Clone, Human, C-OFPSpark® tag HG16961-ACR
TMEM60 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16961-CF
TMEM60 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16961-NF
TMEM60 cDNA ORF Clone, Human, C-His tag HG16961-CH
TMEM60 cDNA ORF Clone, Human, N-His tag HG16961-NH
TMEM60 cDNA ORF Clone, Human, C-HA tag HG16961-CY
TMEM60 cDNA ORF Clone, Human, N-HA tag HG16961-NY
TMEM60 cDNA ORF Clone, Human, C-Myc tag HG16961-CM
TMEM60 cDNA ORF Clone, Human, N-Myc tag HG16961-NM
info info
添加购物车成功! 添加购物车失败!