TMEM33 cDNA ORF Clone, Rat, C-HA tag

Cat: RG80631-CY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All TMEM33 Reagents
CRO Services
Product recommended

All TMEM33 Reagents
TMEM33 cDNA ORF Clone, Rat, C-HA tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
741 bp
Description
Full length Clone DNA of Rat transmembrane protein 33 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TMEM33 Background Information
Full Name
transmembrane protein 33

TMEM33 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
TMEM33 cDNA ORF Clone in Cloning Vector, Rhesus CG90461-G
TMEM33 cDNA ORF Clone, Rhesus, untagged CG90461-UT
TMEM33 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90461-ACGLN
TMEM33 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90461-ACG
TMEM33 cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90461-ANG
TMEM33 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90461-ACR
TMEM33 cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90461-ANR
TMEM33 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90461-CF
TMEM33 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90461-NF
TMEM33 cDNA ORF Clone, Rhesus, C-His tag CG90461-CH
TMEM33 cDNA ORF Clone, Rhesus, N-His tag CG90461-NH
TMEM33 cDNA ORF Clone, Rhesus, C-HA tag CG90461-CY
TMEM33 cDNA ORF Clone, Rhesus, N-HA tag CG90461-NY
TMEM33 cDNA ORF Clone, Rhesus, C-Myc tag CG90461-CM
TMEM33 cDNA ORF Clone, Rhesus, N-Myc tag CG90461-NM

TMEM33 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
TMEM33 cDNA ORF Clone in Cloning Vector, Rat RG80631-U
TMEM33 cDNA ORF Clone, Rat, untagged RG80631-UT
TMEM33 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80631-ACGLN
TMEM33 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80631-ACG
TMEM33 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80631-ANG
TMEM33 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80631-ACR
TMEM33 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80631-ANR
TMEM33 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80631-CF
TMEM33 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80631-NF
TMEM33 cDNA ORF Clone, Rat, C-His tag RG80631-CH
TMEM33 cDNA ORF Clone, Rat, N-His tag RG80631-NH
TMEM33 cDNA ORF Clone, Rat, N-HA tag RG80631-NY
TMEM33 cDNA ORF Clone, Rat, C-Myc tag RG80631-CM
TMEM33 cDNA ORF Clone, Rat, N-Myc tag RG80631-NM
TMEM33 qPCR Primer Pairs, Rat RP300595

TMEM33 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TMEM33 cDNA ORF Clone in Cloning Vector, Mouse MG53928-U
TMEM33 cDNA ORF Clone, Mouse, untagged MG53928-UT
TMEM33 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53928-ACGLN
TMEM33 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53928-ACG
TMEM33 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53928-ACR
TMEM33 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53928-CF
TMEM33 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53928-NF
TMEM33 cDNA ORF Clone, Mouse, C-His tag MG53928-CH
TMEM33 cDNA ORF Clone, Mouse, N-His tag MG53928-NH
TMEM33 cDNA ORF Clone, Mouse, C-HA tag MG53928-CY
TMEM33 cDNA ORF Clone, Mouse, N-HA tag MG53928-NY
TMEM33 cDNA ORF Clone, Mouse, C-Myc tag MG53928-CM
TMEM33 cDNA ORF Clone, Mouse, N-Myc tag MG53928-NM

TMEM33 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TMEM33 cDNA ORF Clone in Cloning Vector, Human HG24727-U
info info
添加购物车成功! 添加购物车失败!