TMEM19 cDNA ORF Clone, Rat, C-His tag

Cat: RG81080-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All TMEM19 Reagents
CRO Services
Product recommended

All TMEM19 Reagents
TMEM19 cDNA ORF Clone, Rat, C-His tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
969 bp
Description
Full length Clone DNA of Rat transmembrane protein 19 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TMEM19 Background Information
Full Name
transmembrane protein 19

TMEM19 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
TMEM19 cDNA ORF Clone in Cloning Vector, Rat RG81080-U
TMEM19 cDNA ORF Clone, Rat, untagged RG81080-UT
TMEM19 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81080-ACGLN
TMEM19 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81080-ACG
TMEM19 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81080-ACR
TMEM19 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81080-CF
TMEM19 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81080-NF
TMEM19 cDNA ORF Clone, Rat, N-His tag RG81080-NH
TMEM19 cDNA ORF Clone, Rat, C-HA tag RG81080-CY
TMEM19 cDNA ORF Clone, Rat, N-HA tag RG81080-NY
TMEM19 cDNA ORF Clone, Rat, C-Myc tag RG81080-CM
TMEM19 cDNA ORF Clone, Rat, N-Myc tag RG81080-NM
TMEM19 qPCR Primer Pairs, Rat RP301037

TMEM19 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TMEM19 cDNA ORF Clone in Cloning Vector, Mouse MG55126-U
TMEM19 cDNA ORF Clone, Mouse, untagged MG55126-UT
TMEM19 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG55126-ACG
TMEM19 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG55126-ACGLN
TMEM19 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG55126-ANG
TMEM19 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG55126-ACR
TMEM19 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG55126-ANR
TMEM19 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG55126-CF
TMEM19 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG55126-NF
TMEM19 cDNA ORF Clone, Mouse, C-His tag MG55126-CH
TMEM19 cDNA ORF Clone, Mouse, N-His tag MG55126-NH
TMEM19 cDNA ORF Clone, Mouse, C-HA tag MG55126-CY
TMEM19 cDNA ORF Clone, Mouse, N-HA tag MG55126-NY
TMEM19 cDNA ORF Clone, Mouse, C-Myc tag MG55126-CM
TMEM19 cDNA ORF Clone, Mouse, N-Myc tag MG55126-NM

TMEM19 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TMEM19 cDNA ORF Clone in Cloning Vector, Human HG28238-U
TMEM19 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG28238-ACGLN
info info
添加购物车成功! 添加购物车失败!