TMEM167A cDNA ORF Clone, Rat, untagged

Cat: RG81098-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All TMEM167A Reagents
CRO Services
Product recommended

All TMEM167A Reagents
TMEM167A cDNA ORF Clone, Rat, untagged General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
219 bp
Description
Full length Clone DNA of Rat transmembrane protein 167A.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TMEM167A Background Information
Full Name
transmembrane protein 167A

TMEM167A cDNA ORF Clone, Rabbit, Related Products

Product Name Catalog#(PDF)
TMEM167A cDNA ORF Clone in Cloning Vector, Rabbit TG65020-G
TMEM167A cDNA ORF Clone, Rabbit, untagged TG65020-UT
TMEM167A cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65020-ACG
TMEM167A Lentiviral cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65020-ACGLN
TMEM167A cDNA ORF Clone, Rabbit, C-OFPSpark® tag TG65020-ACR
TMEM167A cDNA ORF Clone, Rabbit, C-DDK (Flag®) tag TG65020-CF
TMEM167A cDNA ORF Clone, Rabbit, N-DDK (Flag®) tag TG65020-NF
TMEM167A cDNA ORF Clone, Rabbit, C-His tag TG65020-CH
TMEM167A cDNA ORF Clone, Rabbit, N-His tag TG65020-NH
TMEM167A cDNA ORF Clone, Rabbit, C-HA tag TG65020-CY
TMEM167A cDNA ORF Clone, Rabbit, N-HA tag TG65020-NY
TMEM167A cDNA ORF Clone, Rabbit, C-Myc tag TG65020-CM
TMEM167A cDNA ORF Clone, Rabbit, N-Myc tag TG65020-NM

TMEM167A cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
TMEM167A cDNA ORF Clone in Cloning Vector, Rat RG81098-U
TMEM167A Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81098-ACGLN
TMEM167A cDNA ORF Clone, Rat, C-GFPSpark® tag RG81098-ACG
TMEM167A cDNA ORF Clone, Rat, C-OFPSpark® tag RG81098-ACR
TMEM167A cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81098-CF
TMEM167A cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81098-NF
TMEM167A cDNA ORF Clone, Rat, C-His tag RG81098-CH
TMEM167A cDNA ORF Clone, Rat, N-His tag RG81098-NH
TMEM167A cDNA ORF Clone, Rat, C-HA tag RG81098-CY
TMEM167A cDNA ORF Clone, Rat, N-HA tag RG81098-NY
TMEM167A cDNA ORF Clone, Rat, C-Myc tag RG81098-CM
TMEM167A cDNA ORF Clone, Rat, N-Myc tag RG81098-NM
TMEM167A qPCR Primer Pairs, Rat RP301055

TMEM167A cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TMEM167A cDNA ORF Clone in Cloning Vector, Human HG26116-U
info info
添加购物车成功! 添加购物车失败!