TMEM130 cDNA ORF Clone, Rat, N-His tag

Cat: RG80572-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All TMEM130 Reagents
CRO Services
Product recommended

All TMEM130 Reagents
TMEM130 cDNA ORF Clone, Rat, N-His tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1275 bp
Description
Full length Clone DNA of Rat transmembrane protein 130 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TMEM130 Background Information
Full Name
transmembrane protein 130

TMEM130 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
TMEM130 cDNA ORF Clone in Cloning Vector, Rat RG80572-U
TMEM130 cDNA ORF Clone, Rat, untagged RG80572-UT
TMEM130 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80572-ACG
TMEM130 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80572-ACGLN
TMEM130 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80572-ACR
TMEM130 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80572-CF
TMEM130 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80572-NF
TMEM130 cDNA ORF Clone, Rat, C-His tag RG80572-CH
TMEM130 cDNA ORF Clone, Rat, C-HA tag RG80572-CY
TMEM130 cDNA ORF Clone, Rat, N-HA tag RG80572-NY
TMEM130 cDNA ORF Clone, Rat, C-Myc tag RG80572-CM
TMEM130 cDNA ORF Clone, Rat, N-Myc tag RG80572-NM
TMEM130 qPCR Primer Pairs, Rat RP300536

TMEM130 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TMEM130 cDNA ORF Clone in Cloning Vector, Mouse MG54992-U
TMEM130 cDNA ORF Clone, Mouse, untagged MG54992-UT
TMEM130 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG54992-ACG
TMEM130 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG54992-ACGLN
TMEM130 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG54992-ACR
TMEM130 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG54992-CF
TMEM130 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG54992-NF
TMEM130 cDNA ORF Clone, Mouse, C-His tag MG54992-CH
TMEM130 cDNA ORF Clone, Mouse, N-His tag MG54992-NH
TMEM130 cDNA ORF Clone, Mouse, C-HA tag MG54992-CY
TMEM130 cDNA ORF Clone, Mouse, N-HA tag MG54992-NY
TMEM130 cDNA ORF Clone, Mouse, C-Myc tag MG54992-CM
TMEM130 cDNA ORF Clone, Mouse, N-Myc tag MG54992-NM
info info
添加购物车成功! 添加购物车失败!