TLR10 cDNA ORF Clone, Rat, C-His tag

Cat: RG80402-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All TLR10 Reagents
CRO Services
Product recommended

All TLR10 Reagents
TLR10 cDNA ORF Clone, Rat, C-His tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
2435 bp
Description
Full length Clone DNA of Rat toll-like receptor 10 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TLR10 Background Information
Full Name
toll like receptor 10

TLR10 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
TLR10 cDNA ORF Clone in Cloning Vector, Rhesus CG90257-G
TLR10 cDNA ORF Clone, Rhesus, untagged CG90257-UT
TLR10 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90257-ACG
TLR10 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90257-ACGLN
TLR10 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90257-ACR
TLR10 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90257-CF
TLR10 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90257-NF
TLR10 cDNA ORF Clone, Rhesus, C-His tag CG90257-CH
TLR10 cDNA ORF Clone, Rhesus, N-His tag CG90257-NH
TLR10 cDNA ORF Clone, Rhesus, C-HA tag CG90257-CY
TLR10 cDNA ORF Clone, Rhesus, N-HA tag CG90257-NY
TLR10 cDNA ORF Clone, Rhesus, C-Myc tag CG90257-CM
TLR10 cDNA ORF Clone, Rhesus, N-Myc tag CG90257-NM

TLR10 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
TLR10 cDNA ORF Clone, Rat, untagged RG80402-UT
TLR10 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80402-ACGLN
TLR10 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80402-CF
TLR10 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80402-NF
TLR10 cDNA ORF Clone, Rat, N-His tag RG80402-NH
TLR10 cDNA ORF Clone, Rat, C-HA tag RG80402-CY
TLR10 cDNA ORF Clone, Rat, N-HA tag RG80402-NY
TLR10 cDNA ORF Clone, Rat, C-Myc tag RG80402-CM
TLR10 cDNA ORF Clone, Rat, N-Myc tag RG80402-NM
TLR10 qPCR Primer Pairs, Rat RP300367

TLR10 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TLR10 cDNA ORF Clone, Human, untagged HG11954-UT
TLR10 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11954-ACGLN
TLR10 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11954-CF
TLR10 qPCR Primer Pairs, Human HP104592
info info
添加购物车成功! 添加购物车失败!