TIMMDC1 cDNA ORF Clone, Rat, untagged

Cat: RG81223-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All TIMMDC1 Reagents
CRO Services
Product recommended

All TIMMDC1 Reagents
TIMMDC1 cDNA ORF Clone, Rat, untagged General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
858 bp
Description
Full length Clone DNA of Rat translocase of inner mitochondrial membrane domain containing 1.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TIMMDC1 Background Information
Full Name
translocase of inner mitochondrial membrane domain containing 1

TIMMDC1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
TIMMDC1 cDNA ORF Clone in Cloning Vector, Rat RG81223-U
TIMMDC1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81223-ACGLN
TIMMDC1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81223-ACG
TIMMDC1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81223-ACR
TIMMDC1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81223-CF
TIMMDC1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81223-NF
TIMMDC1 cDNA ORF Clone, Rat, C-His tag RG81223-CH
TIMMDC1 cDNA ORF Clone, Rat, N-His tag RG81223-NH
TIMMDC1 cDNA ORF Clone, Rat, C-HA tag RG81223-CY
TIMMDC1 cDNA ORF Clone, Rat, N-HA tag RG81223-NY
TIMMDC1 cDNA ORF Clone, Rat, C-Myc tag RG81223-CM
TIMMDC1 cDNA ORF Clone, Rat, N-Myc tag RG81223-NM
TIMMDC1 qPCR Primer Pairs, Rat RP301179

TIMMDC1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TIMMDC1 cDNA ORF Clone in Cloning Vector, Human HG16250-G
TIMMDC1 cDNA ORF Clone, Human, untagged HG16250-UT
TIMMDC1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16250-ACGLN
TIMMDC1 cDNA ORF Clone, Human, C-GFPSpark® tag HG16250-ACG
TIMMDC1 cDNA ORF Clone, Human, C-OFPSpark® tag HG16250-ACR
TIMMDC1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16250-CF
TIMMDC1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16250-NF
TIMMDC1 cDNA ORF Clone, Human, C-His tag HG16250-CH
TIMMDC1 cDNA ORF Clone, Human, N-His tag HG16250-NH
TIMMDC1 cDNA ORF Clone, Human, C-HA tag HG16250-CY
TIMMDC1 cDNA ORF Clone, Human, N-HA tag HG16250-NY
TIMMDC1 cDNA ORF Clone, Human, C-Myc tag HG16250-CM
TIMMDC1 cDNA ORF Clone, Human, N-Myc tag HG16250-NM
TIMMDC1 qPCR Primer Pairs, Human HP105014
info info
添加购物车成功! 添加购物车失败!