Thrombomodulin cDNA ORF Clone, Rat, C-HA tag

Cat: RG80348-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Thrombomodulin Reagents
CRO Services
Product recommended

All Thrombomodulin Reagents
Thrombomodulin cDNA ORF Clone, Rat, C-HA tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1734 bp
Description
Full length Clone DNA of Rat thrombomodulin with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Thrombomodulin Background Information

Thrombomodulin, also known as THBD(CD141), is an integral membrane protein which reduces blood coagulation by converting thrombin to an anticoagulant enzyme from a procoagulant enzyme. Thrombomodulin is expressed on the surface of endothelial cells and serves as a cofactor for thrombin. It is also expressed on human mesothelial cell, monocyte and a dendritic cell subset. Thrombomodulin functions as a cofactor in the thrombin-induced activation of protein C in the anticoagulant pathway by forming a 1:1 stoichiometric complex with thrombin. Thrombomodulin also regulates C3b inactivation by factor I. Mutations in the thrombomodulin gene have also been reported to be associated with atypical hemolytic-uremic syndrome.

Full Name
thrombomodulin
References
  • Dzionek A, et al. (2002) Plasmacytoid dendritic cells: from specific surface markers to specific cellular functions. Hum Immunol. 63(12):1133-48.
  • Dzionek A, et al. (2000) BDCA-2, BDCA-3, and BDCA-4: three markers for distinct subsets of dendritic cells in human peripheral blood. J Immunol. 165(11):6037-46.
  • Wen DZ, et al. (1987) Human thrombomodulin: complete cDNA sequence and chromosome localization of the gene. Biochemistry. 26(14):4350-7.
  • Thrombomodulin cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    Thrombomodulin cDNA ORF Clone in Cloning Vector, Rhesus CG90216-G
    Thrombomodulin cDNA ORF Clone, Rhesus, untagged CG90216-UT
    Thrombomodulin Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90216-ACGLN
    Thrombomodulin cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90216-ACG
    Thrombomodulin cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90216-ACR
    Thrombomodulin cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90216-CF
    Thrombomodulin cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90216-NF
    Thrombomodulin cDNA ORF Clone, Rhesus, C-His tag CG90216-CH
    Thrombomodulin cDNA ORF Clone, Rhesus, N-His tag CG90216-NH
    Thrombomodulin cDNA ORF Clone, Rhesus, C-HA tag CG90216-CY
    Thrombomodulin cDNA ORF Clone, Rhesus, N-HA tag CG90216-NY
    Thrombomodulin cDNA ORF Clone, Rhesus, C-Myc tag CG90216-CM
    Thrombomodulin cDNA ORF Clone, Rhesus, N-Myc tag CG90216-NM

    Thrombomodulin cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Thrombomodulin cDNA ORF Clone in Cloning Vector, Rat RG80348-G
    Thrombomodulin cDNA ORF Clone, Rat, untagged RG80348-UT
    Thrombomodulin cDNA ORF Clone, Rat, C-GFPSpark® tag RG80348-ACG
    Thrombomodulin Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80348-ACGLN
    Thrombomodulin cDNA ORF Clone, Rat, C-OFPSpark® tag RG80348-ACR
    Thrombomodulin cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80348-CF
    Thrombomodulin cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80348-NF
    Thrombomodulin cDNA ORF Clone, Rat, C-His tag RG80348-CH
    Thrombomodulin cDNA ORF Clone, Rat, N-His tag RG80348-NH
    Thrombomodulin cDNA ORF Clone, Rat, N-HA tag RG80348-NY
    Thrombomodulin cDNA ORF Clone, Rat, C-Myc tag RG80348-CM
    Thrombomodulin cDNA ORF Clone, Rat, N-Myc tag RG80348-NM
    Thrombomodulin qPCR Primer Pairs, Rat RP300318

    Thrombomodulin cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Thrombomodulin cDNA ORF Clone in Cloning Vector, Mouse MG50814-G
    Thrombomodulin cDNA ORF Clone, Mouse, untagged MG50814-UT
    Thrombomodulin cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50814-ACG
    Thrombomodulin Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50814-ACGLN
    Thrombomodulin cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50814-ACR
    Thrombomodulin cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50814-CF
    Thrombomodulin cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50814-NF
    Thrombomodulin cDNA ORF Clone, Mouse, C-His tag MG50814-CH
    Thrombomodulin cDNA ORF Clone, Mouse, N-His tag MG50814-NH
    Thrombomodulin cDNA ORF Clone, Mouse, C-HA tag MG50814-CY
    Thrombomodulin cDNA ORF Clone, Mouse, N-HA tag MG50814-NY
    Thrombomodulin cDNA ORF Clone, Mouse, C-Myc tag MG50814-CM
    Thrombomodulin cDNA ORF Clone, Mouse, N-Myc tag MG50814-NM
    Thrombomodulin qPCR Primer Pairs, Mouse MP200785

    Thrombomodulin cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Thrombomodulin cDNA ORF Clone in Cloning Vector, Human HG11864-U
    Thrombomodulin cDNA ORF Clone, Human, untagged HG11864-UT
    Thrombomodulin cDNA ORF Clone, Human, C-GFPSpark® tag HG11864-ACG
    Thrombomodulin Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11864-ACGLN
    Thrombomodulin cDNA ORF Clone, Human, C-OFPSpark® tag HG11864-ACR
    Thrombomodulin cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11864-CF
    Thrombomodulin cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11864-NF
    Thrombomodulin cDNA ORF Clone, Human, C-His tag HG11864-CH
    Thrombomodulin cDNA ORF Clone, Human, N-His tag HG11864-NH
    Thrombomodulin cDNA ORF Clone, Human, C-HA tag HG11864-CY
    Thrombomodulin cDNA ORF Clone, Human, N-HA tag HG11864-NY
    Thrombomodulin cDNA ORF Clone, Human, C-Myc tag HG11864-CM
    Thrombomodulin cDNA ORF Clone, Human, N-Myc tag HG11864-NM
    Thrombomodulin qPCR Primer Pairs, Human HP104646
    info info
    添加购物车成功! 添加购物车失败!