Transglutaminase 2 cDNA ORF Clone, Rat, N-HA tag

Cat: RG80519-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Transglutaminase 2 Reagents
CRO Services
Product recommended

All Transglutaminase 2 Reagents
Transglutaminase 2 cDNA ORF Clone, Rat, N-HA tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
2061 bp
Description
Full length Clone DNA of Rat transglutaminase 2, C polypeptide with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Transglutaminase 2 Background Information

Protein-glutamine gamma-glutamyltransferase 2, also known as Tissue transglutaminase, Transglutaminase C, Transglutaminase-2, and TGM2, is a member of the transglutaminase superfamily. TGM2 plays a role in cell growth and survival through the anti-apoptosis signaling pathway. It is a calcium-dependent acyltransferase which also undergoes a GTP-binding/GTPase cycle even though it lacks any obvious sequence similarity with canonical GTP-binding (G) proteins. TGM2 is a multi-functional protein which catalyzes transamidation reactions or acts as a G-protein in intracellular signalling. As an enzyme which is responsible for the majority of transglutaminase (TG) activity in the brain, TGM2 is likely to play a modulatory role in nervous system development and has regulatory effect on neuronal cell death as well. Most importantly, numerous studies have presented data demonstrating that dysregulation of TGM2 may contribute to the pathogenesis of many neurodegenerative disorders, including Huntington's disease, Alzheimer's disease, Parkinson's disease and amyotrophic lateral sclerosis as well as nervous system injuries.

Full Name
transglutaminase 2
References
  • Ruan Q, et al. (2007) Transglutaminase 2 in neurodegenerative disorders. Front Biosci. 12: 891-904.
  • Ai L, et al. (2008) The transglutaminase 2 gene (TGM2), a potential molecular marker for chemotherapeutic drug sensitivity, is epigenetically silenced in breast cancer. Carcinogenesis. 29(3): 510-8.
  • Filiano AJ, et al. (2010) Transglutaminase 2 protects against ischemic stroke. Neurobiol Dis. 39(3): 334-43.
  • Park D, et al. (2010) Transglutaminase 2: a multi-functional protein in multiple subcellular compartments. Amino Acids. 39(3): 619-31.
  • Miyoshi N, et al. (2010) TGM2 is a novel marker for prognosis and therapeutic target in colorectal cancer. Ann Surg Oncol. 17(4): 967-72.
  • Transglutaminase 2 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Transglutaminase 2 cDNA ORF Clone in Cloning Vector, Rat RG80519-U
    Transglutaminase 2 cDNA ORF Clone, Rat, untagged RG80519-UT
    Transglutaminase 2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80519-ACG
    Transglutaminase 2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80519-ACGLN
    Transglutaminase 2 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80519-ANG
    Transglutaminase 2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80519-ACR
    Transglutaminase 2 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80519-ANR
    Transglutaminase 2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80519-CF
    Transglutaminase 2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80519-NF
    Transglutaminase 2 cDNA ORF Clone, Rat, C-His tag RG80519-CH
    Transglutaminase 2 cDNA ORF Clone, Rat, N-His tag RG80519-NH
    Transglutaminase 2 cDNA ORF Clone, Rat, C-HA tag RG80519-CY
    Transglutaminase 2 cDNA ORF Clone, Rat, C-Myc tag RG80519-CM
    Transglutaminase 2 cDNA ORF Clone, Rat, N-Myc tag RG80519-NM
    Transglutaminase 2 qPCR Primer Pairs, Rat RP300483

    Transglutaminase 2 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Transglutaminase 2 cDNA ORF Clone in Cloning Vector, Mouse MG53874-U
    Transglutaminase 2 cDNA ORF Clone, Mouse, untagged MG53874-UT
    Transglutaminase 2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53874-ACGLN
    Transglutaminase 2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53874-ACG
    Transglutaminase 2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53874-ANG
    Transglutaminase 2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53874-ACR
    Transglutaminase 2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53874-ANR
    Transglutaminase 2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53874-CF
    Transglutaminase 2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53874-NF
    Transglutaminase 2 cDNA ORF Clone, Mouse, C-His tag MG53874-CH
    Transglutaminase 2 cDNA ORF Clone, Mouse, N-His tag MG53874-NH
    Transglutaminase 2 cDNA ORF Clone, Mouse, C-HA tag MG53874-CY
    Transglutaminase 2 cDNA ORF Clone, Mouse, N-HA tag MG53874-NY
    Transglutaminase 2 cDNA ORF Clone, Mouse, C-Myc tag MG53874-CM
    Transglutaminase 2 cDNA ORF Clone, Mouse, N-Myc tag MG53874-NM

    Transglutaminase 2 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Transglutaminase 2 cDNA ORF Clone in Cloning Vector, Human HG11095-M
    Transglutaminase 2 cDNA ORF Clone, Human, untagged HG11095-UT
    Transglutaminase 2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11095-ACGLN
    Transglutaminase 2 cDNA ORF Clone, Human, C-GFPSpark® tag HG11095-ACG
    Transglutaminase 2 cDNA ORF Clone, Human, N-GFPSpark® tag HG11095-ANG
    Transglutaminase 2 cDNA ORF Clone, Human, C-OFPSpark® tag HG11095-ACR
    Transglutaminase 2 cDNA ORF Clone, Human, N-OFPSpark® tag HG11095-ANR
    Transglutaminase 2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11095-CF
    Transglutaminase 2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11095-NF
    Transglutaminase 2 cDNA ORF Clone, Human, C-His tag HG11095-CH
    Transglutaminase 2 cDNA ORF Clone, Human, N-His tag HG11095-NH
    Transglutaminase 2 cDNA ORF Clone, Human, C-HA tag HG11095-CY
    Transglutaminase 2 cDNA ORF Clone, Human, N-HA tag HG11095-NY
    Transglutaminase 2 cDNA ORF Clone, Human, C-Myc tag HG11095-CM
    Transglutaminase 2 cDNA ORF Clone, Human, N-Myc tag HG11095-NM
    Transglutaminase 2 qPCR Primer Pairs, Human HP101010
    info info
    添加购物车成功! 添加购物车失败!