Text Size:AAA

Rat TGFBR2 Gene ORF cDNA clone expression plasmid, N-HA tag

    DatasheetReviewsRelated ProductsProtocols
    Rat TGFBR2 cDNA Clone Product Information
    NCBI RefSeq:NM_031132.3
    RefSeq ORF Size:1704bp
    cDNA Description:Full length Clone DNA of Rattus norvegicus transforming growth factor, beta receptor II with N terminal HA tag.
    Gene Synonym:Tgfbr2T, TGF-beta2, Tgfbr2
    Species:Rat
    Vector:pCMV3-SP-N-HA
    Plasmid:
    Restriction Site:
    Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with TGFBR2 qPCR primers for gene expression analysis, RP300135 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Product nameProduct name
    Background

    TGFBR2 is member of the Ser/Thr protein kinase family and the TGFB receptor subfamily. It is a transmembrane protein. TGFBR2 is comprised by a C-terminal protein kinase domain and an N-terminal ectodomain. The ectodomain consists of a compact fold containing nine beta-strands and a single helix stabilised by a network of six intra strand disulphide bonds. The folding topology includes a central five-stranded antiparallel beta-sheet, eight-residues long at its centre, covered by a second layer consisting of two segments of two-stranded antiparallel beta-sheets. TGFBR2 has a protein kinase domain, forms a heterodimeric complex with another receptor protein, and binds TGF-beta. This receptor/ligand complex phosphorylates proteins, which then enter the nucleus and regulate the transcription of a subset of genes related to cell proliferation. Mutations in TGFBR2 gene have been associated with Marfan syndrome, Loeys-Deitz Aortic Aneurysm Syndrome, and the development of various types of tumors. TGFBR2 attenuates the biological activities of TGF-beta in colorectal cancer. TGFBR2 expression is increased in oral squamous cell carcinoma cells. Its expression is decreased by IL-1beta while inducing Sp3 via NFkappaB. TGFB2 and TGFBR2 are involved in the antiestrogenic activity.

    References
  • Yu Y, et al. (2012) MicroRNA-21 induces stemness by downregulating transforming growth factor beta receptor 2 (TGFβR2) in colon cancer cells. Carcinogenesis. 33(1):68-76.
  • Shima K, et al. (2011) TGFBR2 and BAX mononucleotide tract mutations, microsatellite instability, and prognosis in 1072 colorectal cancers. PLoS One. 6(9):e25062.
  • Biros E, et al. (2011) Meta-analysis of the association between single nucleotide polymorphisms in TGF-β receptor genes and abdominal aortic aneurysm. Atherosclerosis. 219(1):218-23.
  • Related Products
    Size / Price
    Catalog: RG80139-NY
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"