TGF-beta 3/TGFB3 cDNA ORF Clone, Rat, C-DDK (Flag®) tag

Cat: RG80127-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All TGF-beta 3/TGFB3 Reagents
CRO Services
Product recommended

All TGF-beta 3/TGFB3 Reagents
TGF-beta 3/TGFB3 cDNA ORF Clone, Rat, C-DDK (Flag®) tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1239 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat transforming growth factor, beta 3 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Restriction Sites
KpnI + XbaI (6kb + 1.28kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
TGF-beta 3/TGFB3 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TGF-beta 3/TGFB3 cDNA ORF Clone, Rat, C-DDK (Flag®) tag Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5609
Rat TGF-beta 3/TGFB3 Gene Expression validated Image 14283
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
TGF-beta 3/TGFB3 Background Information
Full Name
transforming growth factor beta 3

TGF-beta 3/TGFB3 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
TGF-beta 3/TGFB3 cDNA ORF Clone in Cloning Vector, Rhesus CG90037-G
TGF-beta 3/TGFB3 cDNA ORF Clone, Rhesus, untagged CG90037-UT
TGF-beta 3/TGFB3 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90037-ACGLN
TGF-beta 3/TGFB3 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90037-ACG
TGF-beta 3/TGFB3 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90037-ACR
TGF-beta 3/TGFB3 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90037-CF
TGF-beta 3/TGFB3 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90037-NF
TGF-beta 3/TGFB3 cDNA ORF Clone, Rhesus, C-His tag CG90037-CH
TGF-beta 3/TGFB3 cDNA ORF Clone, Rhesus, N-His tag CG90037-NH
TGF-beta 3/TGFB3 cDNA ORF Clone, Rhesus, C-HA tag CG90037-CY
TGF-beta 3/TGFB3 cDNA ORF Clone, Rhesus, N-HA tag CG90037-NY
TGF-beta 3/TGFB3 cDNA ORF Clone, Rhesus, C-Myc tag CG90037-CM
TGF-beta 3/TGFB3 cDNA ORF Clone, Rhesus, N-Myc tag CG90037-NM

TGF-beta 3/TGFB3 cDNA ORF Clone, Canine, Related Products

Product Name Catalog#(PDF)
TGF-beta 3/TGFB3 cDNA ORF Clone in Cloning Vector, Canine DG70076-G
TGF-beta 3/TGFB3 cDNA ORF Clone, Canine, untagged DG70076-UT
TGF-beta 3/TGFB3 cDNA ORF Clone, Canine, C-GFPSpark® tag DG70076-ACG
TGF-beta 3/TGFB3 Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70076-ACGLN
TGF-beta 3/TGFB3 cDNA ORF Clone, Canine, C-OFPSpark® tag DG70076-ACR
TGF-beta 3/TGFB3 cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70076-CF
TGF-beta 3/TGFB3 cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70076-NF
TGF-beta 3/TGFB3 cDNA ORF Clone, Canine, C-His tag DG70076-CH
TGF-beta 3/TGFB3 cDNA ORF Clone, Canine, N-His tag DG70076-NH
TGF-beta 3/TGFB3 cDNA ORF Clone, Canine, C-HA tag DG70076-CY
TGF-beta 3/TGFB3 cDNA ORF Clone, Canine, N-HA tag DG70076-NY
TGF-beta 3/TGFB3 cDNA ORF Clone, Canine, C-Myc tag DG70076-CM
TGF-beta 3/TGFB3 cDNA ORF Clone, Canine, N-Myc tag DG70076-NM

TGF-beta 3/TGFB3 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
TGF-beta 3/TGFB3 cDNA ORF Clone in Cloning Vector, Rat RG80127-G
TGF-beta 3/TGFB3 cDNA ORF Clone, Rat, untagged RG80127-UT
TGF-beta 3/TGFB3 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80127-ACGLN
TGF-beta 3/TGFB3 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80127-ACG
TGF-beta 3/TGFB3 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80127-ACR
TGF-beta 3/TGFB3 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80127-NF
TGF-beta 3/TGFB3 cDNA ORF Clone, Rat, C-His tag RG80127-CH
TGF-beta 3/TGFB3 cDNA ORF Clone, Rat, N-His tag RG80127-NH
TGF-beta 3/TGFB3 cDNA ORF Clone, Rat, C-HA tag RG80127-CY
TGF-beta 3/TGFB3 cDNA ORF Clone, Rat, N-HA tag RG80127-NY
TGF-beta 3/TGFB3 cDNA ORF Clone, Rat, C-Myc tag RG80127-CM
TGF-beta 3/TGFB3 cDNA ORF Clone, Rat, N-Myc tag RG80127-NM
TGF-beta 3/TGFB3 qPCR Primer Pairs, Rat RP300122

TGF-beta 3/TGFB3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TGF-beta 3/TGFB3 cDNA ORF Clone, Mouse, untagged MG50519-M-N
TGF-beta 3/TGFB3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50519-ACGLN
TGF-beta 3/TGFB3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50519-M-F
TGF-beta 3/TGFB3 qPCR Primer Pairs, Mouse MP200511

TGF-beta 3/TGFB3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TGF-beta 3/TGFB3 cDNA ORF Clone in Cloning Vector, Human HG10434-M
TGF-beta 3/TGFB3 cDNA ORF Clone, Human, untagged HG10434-UT
TGF-beta 3/TGFB3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10434-ACGLN
TGF-beta 3/TGFB3 cDNA ORF Clone, Human, C-GFPSpark® tag HG10434-ACG
TGF-beta 3/TGFB3 cDNA ORF Clone, Human, C-OFPSpark® tag HG10434-ACR
TGF-beta 3/TGFB3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10434-CF
TGF-beta 3/TGFB3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10434-NF
TGF-beta 3/TGFB3 cDNA ORF Clone, Human, C-His tag HG10434-CH
TGF-beta 3/TGFB3 cDNA ORF Clone, Human, N-His tag HG10434-NH
TGF-beta 3/TGFB3 cDNA ORF Clone, Human, C-HA tag HG10434-CY
TGF-beta 3/TGFB3 cDNA ORF Clone, Human, N-HA tag HG10434-NY
TGF-beta 3/TGFB3 cDNA ORF Clone, Human, C-Myc tag HG10434-CM
TGF-beta 3/TGFB3 cDNA ORF Clone, Human, N-Myc tag HG10434-NM
TGF-beta 3/TGFB3 qPCR Primer Pairs, Human HP100464
info info
添加购物车成功! 添加购物车失败!