Transferrin cDNA ORF Clone, Rat, N-His tag

Cat: RG80586-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Transferrin Reagents
CRO Services
Product recommended

All Transferrin Reagents
Transferrin cDNA ORF Clone, Rat, N-His tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
2097 bp
Description
Full length Clone DNA of Rat transferrin with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Transferrin Background Information

Transferrin is a glycoprotein with an approximate molecular weight of 76.5 kDa. This glycoprotein is thought to have been created as a result of an ancient gene duplication event that led to generation of homologous C and N-terminal domains each of which binds one ion of ferric iron. The function of Transferrin is to transport iron from the intestine, reticuloendothelial system, and liver parenchymal cells to all proliferating cells in the body. This protein may also have a physiologic role as granulocyte / pollen-binding protein (GPBP) involved in the removal of certain organic matter and allergens from serum. Transferrins are iron binding transport proteins which bind Fe3+ ion in association with the binding of an anion, usually bicarbonate. This transferrin binds only one Fe3+ ion per protein molecule. Transports iron ions from the hemolymph into the eggs during the vitellogenic stage. Transferrins are iron binding transport proteins which can bind two Fe(3+) ions in association with the binding of an anion, usually bicarbonate. It is responsible for the transport of iron from sites of absorption and heme degradation to those of storage and utilization. Serum transferrin may also have a further role in stimulating cell proliferation. When a transferrin loaded with iron encounters with a transferring receptor on cell surface, transferring binds to it and, as a consequence, is transported into the cell in a visicle by receptor-mediated endocytosis. The PH is reduced by hydrogen iron pumps. The lower pH causes transferrin to release its iron ions. The receptor is then transported through the endocytic cycle back to the cell surface, ready for another round of iron uptake. Each transferrin molecule has the ability to carry two iron ions in the ferric form.

Full Name
transferrin
References
  • Ponka P, et al. (1998) Function and regulation of transferrin and ferritin. Semin Hematol. 35(1): 35-54.
  • Wagner E, et al. (1990) Transferrin-polycation conjugates as carriers for DNA uptake into cells. Proc Natl Acad Sci. 87(9): 3410-4.
  • Cheng Y, et al. (2004) Structure of the human transferrin receptor-transferrin complex. Cell. 116 (4): 565-76.
  • Transferrin cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Transferrin cDNA ORF Clone in Cloning Vector, Rat RG80586-U
    Transferrin cDNA ORF Clone, Rat, untagged RG80586-UT
    Transferrin Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80586-ACGLN
    Transferrin cDNA ORF Clone, Rat, C-GFPSpark® tag RG80586-ACG
    Transferrin cDNA ORF Clone, Rat, C-OFPSpark® tag RG80586-ACR
    Transferrin cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80586-CF
    Transferrin cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80586-NF
    Transferrin cDNA ORF Clone, Rat, C-His tag RG80586-CH
    Transferrin cDNA ORF Clone, Rat, C-HA tag RG80586-CY
    Transferrin cDNA ORF Clone, Rat, N-HA tag RG80586-NY
    Transferrin cDNA ORF Clone, Rat, C-Myc tag RG80586-CM
    Transferrin cDNA ORF Clone, Rat, N-Myc tag RG80586-NM
    Transferrin qPCR Primer Pairs, Rat RP300550

    Transferrin cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Transferrin cDNA ORF Clone in Cloning Vector, Human HG11019-M
    Transferrin cDNA ORF Clone, Human, untagged HG11019-UT
    Transferrin Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11019-ACGLN
    Transferrin cDNA ORF Clone, Human, C-GFPSpark® tag HG11019-ACG
    Transferrin cDNA ORF Clone, Human, C-OFPSpark® tag HG11019-ACR
    Transferrin cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11019-CF
    Transferrin cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11019-NF
    Transferrin cDNA ORF Clone, Human, C-His tag HG11019-CH
    Transferrin cDNA ORF Clone, Human, N-His tag HG11019-NH
    Transferrin cDNA ORF Clone, Human, C-HA tag HG11019-CY
    Transferrin cDNA ORF Clone, Human, N-HA tag HG11019-NY
    Transferrin cDNA ORF Clone, Human, C-Myc tag HG11019-CM
    Transferrin cDNA ORF Clone, Human, N-Myc tag HG11019-NM
    Transferrin qPCR Primer Pairs, Human HP100980

    Transferrin cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Transferrin qPCR Primer Pairs, Mouse MP200788
    info info
    添加购物车成功! 添加购物车失败!