Quick Order

Rat Transferrin/TF Gene ORF cDNA clone expression plasmid, N-HA tag

DatasheetReviewsRelated ProductsProtocols
Rat TF cDNA Clone Product Information
NCBI RefSeq:NM_001013110.1
RefSeq ORF Size:2097bp
cDNA Description:Full length Clone DNA of Rattus norvegicus transferrin with N terminal HA tag.
Gene Synonym:Tfn, Trf
Species:Rat
Vector:pCMV3-SP-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Transferrin is a glycoprotein with an approximate molecular weight of 76.5 kDa. This glycoprotein is thought to have been created as a result of an ancient gene duplication event that led to generation of homologous C and N-terminal domains each of which binds one ion of ferric iron. The function of Transferrin is to transport iron from the intestine, reticuloendothelial system, and liver parenchymal cells to all proliferating cells in the body. This protein may also have a physiologic role as granulocyte / pollen-binding protein (GPBP) involved in the removal of certain organic matter and allergens from serum. Transferrins are iron binding transport proteins which bind Fe3+ ion in association with the binding of an anion, usually bicarbonate. This transferrin binds only one Fe3+ ion per protein molecule. Transports iron ions from the hemolymph into the eggs during the vitellogenic stage. Transferrins are iron binding transport proteins which can bind two Fe(3+) ions in association with the binding of an anion, usually bicarbonate. It is responsible for the transport of iron from sites of absorption and heme degradation to those of storage and utilization. Serum transferrin may also have a further role in stimulating cell proliferation. When a transferrin loaded with iron encounters with a transferring receptor on cell surface, transferring binds to it and, as a consequence, is transported into the cell in a visicle by receptor-mediated endocytosis. The PH is reduced by hydrogen iron pumps. The lower pH causes transferrin to release its iron ions. The receptor is then transported through the endocytic cycle back to the cell surface, ready for another round of iron uptake. Each transferrin molecule has the ability to carry two iron ions in the ferric form.

References
  • Ponka P, et al. (1998) Function and regulation of transferrin and ferritin. Semin Hematol. 35(1): 35-54.
  • Wagner E, et al. (1990) Transferrin-polycation conjugates as carriers for DNA uptake into cells. Proc Natl Acad Sci. 87(9): 3410-4.
  • Cheng Y, et al. (2004) Structure of the human transferrin receptor-transferrin complex. Cell. 116 (4): 565-76.
  • Size / Price
    Catalog: RG80586-NY
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"