TEX261 cDNA ORF Clone, Rat, N-Myc tag

Cat: RG80940-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All TEX261 Reagents
CRO Services
Product recommended

All TEX261 Reagents
TEX261 cDNA ORF Clone, Rat, N-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
591 bp
Description
Full length Clone DNA of Rat testis expressed 261 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TEX261 Background Information
Full Name
testis expressed 261

TEX261 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
TEX261 cDNA ORF Clone in Cloning Vector, Rat RG80940-U
TEX261 cDNA ORF Clone, Rat, untagged RG80940-UT
TEX261 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80940-ACGLN
TEX261 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80940-ACG
TEX261 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80940-ANG
TEX261 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80940-ACR
TEX261 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80940-ANR
TEX261 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80940-CF
TEX261 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80940-NF
TEX261 cDNA ORF Clone, Rat, C-His tag RG80940-CH
TEX261 cDNA ORF Clone, Rat, N-His tag RG80940-NH
TEX261 cDNA ORF Clone, Rat, C-HA tag RG80940-CY
TEX261 cDNA ORF Clone, Rat, N-HA tag RG80940-NY
TEX261 cDNA ORF Clone, Rat, C-Myc tag RG80940-CM
TEX261 qPCR Primer Pairs, Rat RP300904

TEX261 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TEX261 cDNA ORF Clone in Cloning Vector, Human HG27335-U
TEX261 cDNA ORF Clone, Human, untagged HG27335-UT
TEX261 cDNA ORF Clone, Human, C-GFPSpark® tag HG27335-ACG
TEX261 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG27335-ACGLN
TEX261 cDNA ORF Clone, Human, N-GFPSpark® tag HG27335-ANG
TEX261 cDNA ORF Clone, Human, C-OFPSpark® tag HG27335-ACR
TEX261 cDNA ORF Clone, Human, N-OFPSpark® tag HG27335-ANR
TEX261 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG27335-CF
TEX261 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG27335-NF
TEX261 cDNA ORF Clone, Human, C-His tag HG27335-CH
TEX261 cDNA ORF Clone, Human, N-His tag HG27335-NH
TEX261 cDNA ORF Clone, Human, C-HA tag HG27335-CY
TEX261 cDNA ORF Clone, Human, N-HA tag HG27335-NY
TEX261 cDNA ORF Clone, Human, C-Myc tag HG27335-CM
TEX261 cDNA ORF Clone, Human, N-Myc tag HG27335-NM
info info
添加购物车成功! 添加购物车失败!