TECR cDNA ORF Clone, Rat, C-HA tag

Cat: RG80660-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All TECR Reagents
CRO Services
Product recommended

All TECR Reagents
TECR cDNA ORF Clone, Rat, C-HA tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
927 bp
Description
Full length Clone DNA of Rat trans-2,3-enoyl-CoA reductase with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TECR Background Information
Full Name
trans-2,3-enoyl-CoA reductase

TECR cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
TECR cDNA ORF Clone in Cloning Vector, Rat RG80660-U
TECR cDNA ORF Clone, Rat, untagged RG80660-UT
TECR Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80660-ACGLN
TECR cDNA ORF Clone, Rat, C-GFPSpark® tag RG80660-ACG
TECR cDNA ORF Clone, Rat, N-GFPSpark® tag RG80660-ANG
TECR cDNA ORF Clone, Rat, C-OFPSpark® tag RG80660-ACR
TECR cDNA ORF Clone, Rat, N-OFPSpark® tag RG80660-ANR
TECR cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80660-CF
TECR cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80660-NF
TECR cDNA ORF Clone, Rat, C-His tag RG80660-CH
TECR cDNA ORF Clone, Rat, N-His tag RG80660-NH
TECR cDNA ORF Clone, Rat, N-HA tag RG80660-NY
TECR cDNA ORF Clone, Rat, C-Myc tag RG80660-CM
TECR cDNA ORF Clone, Rat, N-Myc tag RG80660-NM
TECR qPCR Primer Pairs, Rat RP300624

TECR cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TECR cDNA ORF Clone in Cloning Vector, Mouse MG52534-G
TECR cDNA ORF Clone, Mouse, untagged MG52534-UT
TECR Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52534-ACGLN
TECR cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52534-ACG
TECR cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52534-ACR
TECR cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52534-CF
TECR cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52534-NF
TECR cDNA ORF Clone, Mouse, C-His tag MG52534-CH
TECR cDNA ORF Clone, Mouse, N-His tag MG52534-NH
TECR cDNA ORF Clone, Mouse, C-HA tag MG52534-CY
TECR cDNA ORF Clone, Mouse, N-HA tag MG52534-NY
TECR cDNA ORF Clone, Mouse, C-Myc tag MG52534-CM
TECR cDNA ORF Clone, Mouse, N-Myc tag MG52534-NM
TECR qPCR Primer Pairs, Mouse MP202407

TECR cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TECR cDNA ORF Clone in Cloning Vector, Human HG16183-G
TECR cDNA ORF Clone, Human, untagged HG16183-UT
TECR cDNA ORF Clone, Human, C-GFPSpark® tag HG16183-ACG
TECR Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16183-ACGLN
TECR cDNA ORF Clone, Human, C-OFPSpark® tag HG16183-ACR
TECR cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16183-CF
TECR cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16183-NF
TECR cDNA ORF Clone, Human, C-His tag HG16183-CH
TECR cDNA ORF Clone, Human, N-His tag HG16183-NH
TECR cDNA ORF Clone, Human, C-HA tag HG16183-CY
TECR cDNA ORF Clone, Human, N-HA tag HG16183-NY
TECR cDNA ORF Clone, Human, C-Myc tag HG16183-CM
TECR cDNA ORF Clone, Human, N-Myc tag HG16183-NM
TECR qPCR Primer Pairs, Human HP104952
info info
添加购物车成功! 添加购物车失败!