Cripto cDNA ORF Clone, Rat, C-Myc tag

Cat: RG80135-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Cripto Reagents
CRO Services
Product recommended

All Cripto Reagents
Cripto cDNA ORF Clone, Rat, C-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
546 bp
Description
Full length Clone DNA of Rat teratocarcinoma-derived growth factor 1 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Cripto Background Information

Cripto/TDGF1 is a member of the epidermal growth factor (EGF)- Cripto, Frl-1, and Cryptic (CFC) family. EGF-CFC family member proteins share a variant EGF-like motif, a conserved cysteine-rich domain, and a C-terminal hydrophobic region. Before gastrulation, Cripto is asymmetrically expressed in a proximal–distal gradient in the epiblast, and subsequently is expressed in the primitive streak and newly formed embryonic mesoderm. These proteins play key roles in intercellular signaling pathways during vertebrate embryogenesis. Mutations in Cripto/TDGF1 can cause autosomal visceral heterotaxy. Cripto/TDGF1 is involved in left-right asymmetric morphogenesis during organ development. Cripto signalling is essential for the conversion of a proximal–distal asymmetry into an orthogonal anterior–posterior axis. The mechanism of inhibitory effects of the Cripto includes both cancer cell apoptosis, activation of c-Jun-NH(2)-terminal kinase and p38 kinase signaling pathways and blocking of Akt phosphorylation. Thus, Cripto is a unique target, and Immunohistochemistry to Cripto could be of therapeutic value for human cancers.

Full Name
teratocarcinoma-derived growth factor 1
References
  • Calvanese L, et al. (2006) Solution structure of mouse Cripto CFC domain and its inactive variant Trp107Ala. J Med Chem. 49 (24): 7054-62.
  • Lonardo E, et al. (2010) A small synthetic cripto blocking Peptide improves neural induction, dopaminergic differentiation, and functional integration of mouse embryonic stem cells in a rat model of Parkinson's disease. Stem Cells. 28 (8): 1326-37.
  • Chambery A, et al. (2009) Qualitative and quantitative proteomic profiling of cripto(-/-) embryonic stem cells by means of accurate mass LC-MS analysis. J Proteome Res. 8 (2): 1047-58.
  • Cripto cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Cripto cDNA ORF Clone in Cloning Vector, Rat RG80135-G
    Cripto cDNA ORF Clone, Rat, untagged RG80135-UT
    Cripto cDNA ORF Clone, Rat, C-GFPSpark® tag RG80135-ACG
    Cripto Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80135-ACGLN
    Cripto cDNA ORF Clone, Rat, C-OFPSpark® tag RG80135-ACR
    Cripto cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80135-CF
    Cripto cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80135-NF
    Cripto cDNA ORF Clone, Rat, C-His tag RG80135-CH
    Cripto cDNA ORF Clone, Rat, N-His tag RG80135-NH
    Cripto cDNA ORF Clone, Rat, C-HA tag RG80135-CY
    Cripto cDNA ORF Clone, Rat, N-HA tag RG80135-NY
    Cripto cDNA ORF Clone, Rat, N-Myc tag RG80135-NM
    Cripto qPCR Primer Pairs, Rat RP300131

    Cripto cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Cripto cDNA ORF Clone in Cloning Vector, Human HG10908-M
    Cripto cDNA ORF Clone, Human, untagged HG10908-UT
    Cripto cDNA ORF Clone, Human, C-GFPSpark® tag HG10908-ACG
    Cripto Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10908-ACGLN
    Cripto cDNA ORF Clone, Human, C-OFPSpark® tag HG10908-ACR
    Cripto cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10908-CF
    Cripto cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10908-NF
    Cripto cDNA ORF Clone, Human, C-His tag HG10908-CH
    Cripto cDNA ORF Clone, Human, N-His tag HG10908-NH
    Cripto cDNA ORF Clone, Human, C-HA tag HG10908-CY
    Cripto cDNA ORF Clone, Human, N-HA tag HG10908-NY
    Cripto cDNA ORF Clone, Human, C-Myc tag HG10908-CM
    Cripto cDNA ORF Clone, Human, N-Myc tag HG10908-NM
    Cripto qPCR Primer Pairs, Human HP100792
    info info
    添加购物车成功! 添加购物车失败!