Quick Order

Rat Cripto/TDGF1/ CRGF Gene ORF cDNA clone expression plasmid, C-Flag tag

DatasheetReviewsRelated ProductsProtocols
Rat TDGF1 cDNA Clone Product Information
NCBI RefSeq:XM_001056317.2
RefSeq ORF Size:546bp
cDNA Description:Full length Clone DNA of Rattus norvegicus teratocarcinoma-derived growth factor 1 with C terminal Flag tag.
Gene Synonym:Tdgf1
Species:Rat
Vector:pCMV3-C-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

Cripto/TDGF1 is a member of the epidermal growth factor (EGF)- Cripto, Frl-1, and Cryptic (CFC) family. EGF-CFC family member proteins share a variant EGF-like motif, a conserved cysteine-rich domain, and a C-terminal hydrophobic region. Before gastrulation, Cripto is asymmetrically expressed in a proximal–distal gradient in the epiblast, and subsequently is expressed in the primitive streak and newly formed embryonic mesoderm. These proteins play key roles in intercellular signaling pathways during vertebrate embryogenesis. Mutations in Cripto/TDGF1 can cause autosomal visceral heterotaxy. Cripto/TDGF1 is involved in left-right asymmetric morphogenesis during organ development. Cripto signalling is essential for the conversion of a proximal–distal asymmetry into an orthogonal anterior–posterior axis. The mechanism of inhibitory effects of the Cripto includes both cancer cell apoptosis, activation of c-Jun-NH(2)-terminal kinase and p38 kinase signaling pathways and blocking of Akt phosphorylation. Thus, Cripto is a unique target, and Immunohistochemistry to Cripto could be of therapeutic value for human cancers.

References
  • Calvanese L, et al. (2006) Solution structure of mouse Cripto CFC domain and its inactive variant Trp107Ala. J Med Chem. 49 (24): 7054-62.
  • Lonardo E, et al. (2010) A small synthetic cripto blocking Peptide improves neural induction, dopaminergic differentiation, and functional integration of mouse embryonic stem cells in a rat model of Parkinson's disease. Stem Cells. 28 (8): 1326-37.
  • Chambery A, et al. (2009) Qualitative and quantitative proteomic profiling of cripto(-/-) embryonic stem cells by means of accurate mass LC-MS analysis. J Proteome Res. 8 (2): 1047-58.
  • Size / Price
    Catalog: RG80135-CF
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"