TBPL1 cDNA ORF Clone, Rat, N-HA tag

Cat: RG80777-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All TBPL1 Reagents
CRO Services
Product recommended

All TBPL1 Reagents
TBPL1 cDNA ORF Clone, Rat, N-HA tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
561 bp
Description
Full length Clone DNA of Rat TBP-like 1 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TBPL1 Background Information
Full Name
TATA box binding protein-like 1

TBPL1 cDNA ORF Clone, Canine, Related Products

Product Name Catalog#(PDF)
TBPL1 cDNA ORF Clone in Cloning Vector, Canine DG70121-U

TBPL1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
TBPL1 cDNA ORF Clone in Cloning Vector, Rat RG80777-U
TBPL1 cDNA ORF Clone, Rat, untagged RG80777-UT
TBPL1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80777-ACGLN
TBPL1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80777-ACG
TBPL1 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80777-ANG
TBPL1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80777-ACR
TBPL1 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80777-ANR
TBPL1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80777-CF
TBPL1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80777-NF
TBPL1 cDNA ORF Clone, Rat, C-His tag RG80777-CH
TBPL1 cDNA ORF Clone, Rat, N-His tag RG80777-NH
TBPL1 cDNA ORF Clone, Rat, C-HA tag RG80777-CY
TBPL1 cDNA ORF Clone, Rat, C-Myc tag RG80777-CM
TBPL1 cDNA ORF Clone, Rat, N-Myc tag RG80777-NM
TBPL1 qPCR Primer Pairs, Rat RP300741

TBPL1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TBPL1 cDNA ORF Clone in Cloning Vector, Human HG12895-U
TBPL1 cDNA ORF Clone, Human, untagged HG12895-UT
TBPL1 cDNA ORF Clone, Human, C-GFPSpark® tag HG12895-ACG
TBPL1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12895-ACGLN
TBPL1 cDNA ORF Clone, Human, N-GFPSpark® tag HG12895-ANG
TBPL1 cDNA ORF Clone, Human, C-OFPSpark® tag HG12895-ACR
TBPL1 cDNA ORF Clone, Human, N-OFPSpark® tag HG12895-ANR
TBPL1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12895-CF
TBPL1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12895-NF
TBPL1 cDNA ORF Clone, Human, C-His tag HG12895-CH
TBPL1 cDNA ORF Clone, Human, N-His tag HG12895-NH
TBPL1 cDNA ORF Clone, Human, C-HA tag HG12895-CY
TBPL1 cDNA ORF Clone, Human, N-HA tag HG12895-NY
TBPL1 cDNA ORF Clone, Human, C-Myc tag HG12895-CM
TBPL1 cDNA ORF Clone, Human, N-Myc tag HG12895-NM
info info
添加购物车成功! 添加购物车失败!