SUOX cDNA ORF Clone, Rat, N-Myc tag

Cat: RG80955-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All SUOX Reagents
CRO Services
Product recommended

All SUOX Reagents
SUOX cDNA ORF Clone, Rat, N-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1641 bp
Description
Full length Clone DNA of Rat sulfite oxidase with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SUOX Background Information
Full Name
sulfite oxidase

SUOX cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
SUOX cDNA ORF Clone in Cloning Vector, Rat RG80955-U
SUOX cDNA ORF Clone, Rat, untagged RG80955-UT
SUOX Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80955-ACGLN
SUOX cDNA ORF Clone, Rat, C-GFPSpark® tag RG80955-ACG
SUOX cDNA ORF Clone, Rat, N-GFPSpark® tag RG80955-ANG
SUOX cDNA ORF Clone, Rat, C-OFPSpark® tag RG80955-ACR
SUOX cDNA ORF Clone, Rat, N-OFPSpark® tag RG80955-ANR
SUOX cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80955-CF
SUOX cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80955-NF
SUOX cDNA ORF Clone, Rat, C-His tag RG80955-CH
SUOX cDNA ORF Clone, Rat, N-His tag RG80955-NH
SUOX cDNA ORF Clone, Rat, C-HA tag RG80955-CY
SUOX cDNA ORF Clone, Rat, N-HA tag RG80955-NY
SUOX cDNA ORF Clone, Rat, C-Myc tag RG80955-CM
SUOX qPCR Primer Pairs, Rat RP300919

SUOX cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SUOX cDNA ORF Clone in Cloning Vector, Human HG18768-U
SUOX cDNA ORF Clone, Human, untagged HG18768-UT
SUOX Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG18768-ACGLN
SUOX cDNA ORF Clone, Human, C-GFPSpark® tag HG18768-ACG
SUOX cDNA ORF Clone, Human, N-GFPSpark® tag HG18768-ANG
SUOX cDNA ORF Clone, Human, C-OFPSpark® tag HG18768-ACR
SUOX cDNA ORF Clone, Human, N-OFPSpark® tag HG18768-ANR
SUOX cDNA ORF Clone, Human, C-DDK (Flag®) tag HG18768-CF
SUOX cDNA ORF Clone, Human, N-DDK (Flag®) tag HG18768-NF
SUOX cDNA ORF Clone, Human, C-His tag HG18768-CH
SUOX cDNA ORF Clone, Human, N-His tag HG18768-NH
SUOX cDNA ORF Clone, Human, C-HA tag HG18768-CY
SUOX cDNA ORF Clone, Human, N-HA tag HG18768-NY
SUOX cDNA ORF Clone, Human, C-Myc tag HG18768-CM
SUOX cDNA ORF Clone, Human, N-Myc tag HG18768-NM
info info
添加购物车成功! 添加购物车失败!