SULT1A1 cDNA ORF Clone, Rat, C-Myc tag

Cat: RG81238-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All SULT1A1 Reagents
CRO Services
Product recommended

All SULT1A1 Reagents
SULT1A1 cDNA ORF Clone, Rat, C-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
876 bp
Description
Full length Clone DNA of Rat sulfotransferase family, cytosolic, 1A, phenol-preferring, member 1 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SULT1A1 Background Information

Sulfate conjugation catalyzed by cytosolic sulfotransferase (SULT) enzymes. The SULTs are Phase II drug-metabolizing enzymes that catalyze the addition of a sulfuryl moiety to both endogenous compounds, including steroids and neurotransmitters, and certain xenobiotics, including N-hydroxy-2-acetylaminoflourine and phenolic compounds, like alpha-naphthol. SULTs may be involved in the individual genetic disposition, species differences, and organotropisms for toxicological effects of chemicals. Particularly SULT1A1 (Sulfotransferase family, cytosolic, 1A, phenol-preferring, member 1), a member of the sulfotransferase 1 subfamily, which is a major pathway for drug metabolism in humans. Humans have at least 10 functional SULT genes. There has been an explosion in information on sulfotransferase polymorphisms and their functional consequences. An Arg213His polymorphism in SULT1A1 has a strong influence on the level of enzyme protein and activity in platelets, which have been widely used for phenotyping. Statistically significant associations were observed between the SULT1A1 genotype (Arg213His) and age, obesity and certain neoplasias (mammary, pulmonary, esophageal and urothelial cancer). Furthermore, the polymorphism of the SULT1A1 may be closely associated with breast cancer.

Full Name
sulfotransferase family, cytosolic, 1A, phenol-preferring, member 1
References
  • Coughtrie MW. 2002. Sulfation through the looking glass--recent advances in sulfotransferase research for the curious. Pharmacogenomics J. 2(5): 297-308.
  • Klaassen CD, et al. (1998) Regulation of sulfotransferase mRNA expression in male and female rats of various ages. Chem Biol Interact. 109(1-3): 299-313.
  • Glatt H. (2000) Sulfotransferases in the bioactivation of xenobiotics. Chem Biol Interact. 129(1-2): 141-70.
  • Glatt H, et al. (2004) Pharmacogenetics of soluble sulfotransferases (SULTs). Naunyn Schmiedebergs Arch Pharmacol. 369(1): 55-68.
  • Hebbring SJ, et al. (2008) Sulfotransferase gene copy number variation: pharmacogenetics and function. Cytogenet Genome Res. 123(1-4): 205-10.
  • SULT1A1 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    SULT1A1 cDNA ORF Clone in Cloning Vector, Rat RG81238-U
    SULT1A1 cDNA ORF Clone, Rat, untagged RG81238-UT
    SULT1A1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81238-ACGLN
    SULT1A1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81238-ACG
    SULT1A1 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81238-ANG
    SULT1A1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81238-ACR
    SULT1A1 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81238-ANR
    SULT1A1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81238-CF
    SULT1A1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81238-NF
    SULT1A1 cDNA ORF Clone, Rat, C-His tag RG81238-CH
    SULT1A1 cDNA ORF Clone, Rat, N-His tag RG81238-NH
    SULT1A1 cDNA ORF Clone, Rat, C-HA tag RG81238-CY
    SULT1A1 cDNA ORF Clone, Rat, N-HA tag RG81238-NY
    SULT1A1 cDNA ORF Clone, Rat, N-Myc tag RG81238-NM
    SULT1A1 qPCR Primer Pairs, Rat RP301194

    SULT1A1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    SULT1A1 cDNA ORF Clone in Cloning Vector, Human HG11658-M
    SULT1A1 cDNA ORF Clone, Human, untagged HG11658-UT
    SULT1A1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11658-ACGLN
    SULT1A1 cDNA ORF Clone, Human, C-GFPSpark® tag HG11658-ACG
    SULT1A1 cDNA ORF Clone, Human, N-GFPSpark® tag HG11658-ANG
    SULT1A1 cDNA ORF Clone, Human, C-OFPSpark® tag HG11658-ACR
    SULT1A1 cDNA ORF Clone, Human, N-OFPSpark® tag HG11658-ANR
    SULT1A1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11658-CF
    SULT1A1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11658-NF
    SULT1A1 cDNA ORF Clone, Human, C-His tag HG11658-CH
    SULT1A1 cDNA ORF Clone, Human, N-His tag HG11658-NH
    SULT1A1 cDNA ORF Clone, Human, C-HA tag HG11658-CY
    SULT1A1 cDNA ORF Clone, Human, N-HA tag HG11658-NY
    SULT1A1 cDNA ORF Clone, Human, C-Myc tag HG11658-CM
    SULT1A1 cDNA ORF Clone, Human, N-Myc tag HG11658-NM
    SULT1A1 qPCR Primer Pairs, Human HP101503
    info info
    添加购物车成功! 添加购物车失败!