After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Rat SULT1A1 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Rat SULT1A1 cDNA Clone Product Information
NCBI RefSeq:NM_031834.1
RefSeq ORF Size:876bp
cDNA Description:Full length Clone DNA of Rattus norvegicus sulfotransferase family, cytosolic, 1A, phenol-preferring, member 1.
Gene Synonym:Stm, Stp1, ASTIV, Mx-ST, PST-1, St1a1, Sult1a3
Species:Rat
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Sulfate conjugation catalyzed by cytosolic sulfotransferase (SULT) enzymes. The SULTs are Phase II drug-metabolizing enzymes that catalyze the addition of a sulfuryl moiety to both endogenous compounds, including steroids and neurotransmitters, and certain xenobiotics, including N-hydroxy-2-acetylaminoflourine and phenolic compounds, like alpha-naphthol. SULTs may be involved in the individual genetic disposition, species differences, and organotropisms for toxicological effects of chemicals. Particularly SULT1A1 (Sulfotransferase family, cytosolic, 1A, phenol-preferring, member 1), a member of the sulfotransferase 1 subfamily, which is a major pathway for drug metabolism in humans. Humans have at least 10 functional SULT genes. There has been an explosion in information on sulfotransferase polymorphisms and their functional consequences. An Arg213His polymorphism in SULT1A1 has a strong influence on the level of enzyme protein and activity in platelets, which have been widely used for phenotyping. Statistically significant associations were observed between the SULT1A1 genotype (Arg213His) and age, obesity and certain neoplasias (mammary, pulmonary, esophageal and urothelial cancer). Furthermore, the polymorphism of the SULT1A1 may be closely associated with breast cancer.

References
  • Coughtrie MW. 2002. Sulfation through the looking glass--recent advances in sulfotransferase research for the curious. Pharmacogenomics J. 2(5): 297-308.
  • Klaassen CD, et al. (1998) Regulation of sulfotransferase mRNA expression in male and female rats of various ages. Chem Biol Interact. 109(1-3): 299-313.
  • Glatt H. (2000) Sulfotransferases in the bioactivation of xenobiotics. Chem Biol Interact. 129(1-2): 141-70.
  • Glatt H, et al. (2004) Pharmacogenetics of soluble sulfotransferases (SULTs). Naunyn Schmiedebergs Arch Pharmacol. 369(1): 55-68.
  • Hebbring SJ, et al. (2008) Sulfotransferase gene copy number variation: pharmacogenetics and function. Cytogenet Genome Res. 123(1-4): 205-10.
  • Size / Price
    Catalog: RG81238-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"